RH127532 Marker Search Result - Rat Genome Database

General

Marker: RH127532

Symbol:

RH127532

Previously known as:

AA818937;

RGD ID:

5039134

Expected Size:

203 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	20	3,329,316 - 3,329,519 (-)	MAPPER	mRatBN7.2
Rnor_6.0	20	5,336,749 - 5,336,951	NCBI	Rnor6.0
Rnor_5.0	20	7,397,810 - 7,398,012	UniSTS	Rnor5.0
RGSC_v3.4	20	3,414,779 - 3,414,981	UniSTS	RGSC3.4
RH 3.4 Map	20	52.72	UniSTS

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	ACTCGAAAGAAGGGAAAGACCC
Reverse Primer	CCTGCTGAACCATTTCACTGTC

Region

Nucleotide Sequences


GenBank Nucleotide	AJ314857	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BX883046	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	DH557147	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH619586.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
724519	Bp144	Blood pressure QTL 144		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	20	1	3624629	Rat
1354642	Despr15	Despair related QTL 15		0.0027	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	20	1	24159021	Rat
1600382	Edcs3	Endometrial carcinoma susceptibility QTL3	3.5	0.003	uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	20	1	25159026	Rat
2317851	Alcrsp22	Alcohol response QTL 22	3.2	0.05	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
1641893	Alcrsp7	Alcohol response QTL 7			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
8694189	Bw153	Body weight QTL 153	3.13	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	20	1	29191651	Rat
9590275	Scort15	Serum corticosterone level QTL 15	3.48	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	29191651	Rat
7411650	Foco23	Food consumption QTL 23	20.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	29191651	Rat
9590109	Sffal8	Serum free fatty acids level QTL 8	5.32	0.01	blood free fatty acid amount (VT:0001553)	plasma free fatty acids level (CMO:0000546)	20	1	29191651	Rat
9589155	Insul32	Insulin level QTL 32	6.38	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	20	1	29191651	Rat
6893685	Bw111	Body weight QTL 111	2.7	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	20	1	32578807	Rat
7411668	Foco32	Food consumption QTL 32	8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	36600972	Rat
9590252	Scort12	Serum corticosterone level QTL 12	20.46	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	36600972	Rat
2305926	Iddm37	Insulin dependent diabetes mellitus QTL 37	6		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	20	1527842	46527842	Rat
2306850	Pia40	Pristane induced arthritis QTL 40		0.0001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	20	1527959	5304575	Rat
1641915	Colcr9	Colorectal carcinoma resistance QTL 9	2.97	0.0024	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	20	1530655	46530655	Rat
1598816	Memor12	Memory QTL 12	2.4		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	20	2606836	47606836	Rat
61448	Ciaa1	CIA Autoantibody QTL 1	30	0.001	blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	20	2646395	4597031	Rat
61472	Aia1	Adjuvant induced arthritis QTL 1	18	0.001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	20	2646395	4597031	Rat
2317057	Aia27	Adjuvant induced arthritis QTL 27	2.83		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	20	2892597	26381954	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
UniSTS	210842	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: RH127532