RH140128 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH140128

Symbol: RH140128
Previously known as: AI230628; 
RGD ID: 5033789
Expected Size: 200 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X12,208,897 - 12,209,097 (+)MAPPERmRatBN7.2
Rnor_6.0X13,261,666 - 13,261,865NCBIRnor6.0
Rnor_5.0X14,051,291 - 14,051,490UniSTSRnor5.0
RGSC_v3.4X24,362,447 - 24,362,646UniSTSRGSC3.4
CeleraX12,822,276 - 12,822,475UniSTS
RH 3.4 MapX99.4UniSTS
Cytogenetic MapXq13UniSTS
Is Marker For: Genes:   Tspan7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGGTGTGGAGAGATCCTGTTA
Reverse Primer GACCTTTGTTTCCCTTCCACAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1589725Tspan7tetraspanin 7X1220878312306092Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631204Gluco15Glucose level QTL 150.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X162371522646544Rat
70165Bp64Blood pressure QTL 645.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X144812931706553Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X143491017Rat
634325Bw13Body weight QTL 130body mass (VT:0001259)body weight (CMO:0000012)X144797220991088Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 363447 UniSTS
UniSTS 222207 UniSTS