RH94638 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH94638

Symbol: RH94638
Previously known as: X59949; 
RGD ID: 5027761
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21238,626,400 - 38,626,588 (+)MAPPERmRatBN7.2
Rnor_6.01244,215,433 - 44,215,620NCBIRnor6.0
Rnor_5.01246,048,975 - 46,049,162UniSTSRnor5.0
Celera1240,283,342 - 40,283,529UniSTS
Cytogenetic Map12q16UniSTS
Is Marker For: Genes:   Nos1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCCTGCAGTGGCTCTCA
Reverse Primer CACCATCATAAAAAGAGGGTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3184Nos1nitric oxide synthase 1123861511138795492Rat
41012245LOC120095990uncharacterized LOC120095990123862418138631305Rat

Nucleotide Sequences
GenBank Nucleotide JH617637.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6556449546669029Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449846669029Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12610757946669029Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12719673046669029Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)12960327746669029Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121047413746669029Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121047413746669029Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382545055165Rat
61404Bw120Body weight QTL 1205.1body mass (VT:0001259)body mass index (BMI) (CMO:0000105)121235161946669029Rat
1641928Alcrsp5Alcohol response QTL 5response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)121281238546669029Rat
2303569Gluco44Glucose level QTL 442blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121281238546669029Rat
1549902Bp269Blood pressure QTL 269arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121318273646669029Rat
1549912Bp268Blood pressure QTL 268arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)101318273646669029Rat
2302060Pia37Pristane induced arthritis QTL 376.10.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)121319815746669029Rat
631560Apr1Acute phase response QTL 16.1orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)121914436246669029Rat
737822Alc10Alcohol consumption QTL 102.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)121961087040218516Rat
5684888Pia42Pristane induced arthritis QTL 42joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121961087042828880Rat
61324Eae5Experimental allergic encephalomyelitis QTL 514nervous system integrity trait (VT:0010566)percentage of study population developing relapsing-remitting experimental autoimmune encephalomyelitis during a period of time (CMO:0001402)121961087046669029Rat
7411643Foco20Food consumption QTL 200.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)122032881946669029Rat
1556747Calcic1Intracellular calcium level QTL 13.6platelet calcium amount (VT:0010500)platelet intracellular calcium level (CMO:0000922)122806443340130419Rat
1300175Cm5Cardiac mass QTL 53.78heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)122806443345899022Rat
1600386Calcic2Intracellular calcium level QTL 20.001platelet physiology trait (VT:0005464)platelet intracellular calcium level (CMO:0000922)122806443346669029Rat
1331787Rf41Renal function QTL 412.998kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)122806455740218380Rat
1300162Bp188Blood pressure QTL 1883.19arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)123210317445899022Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24598 UniSTS
UniSTS 119885 UniSTS