RH128380 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH128380

Symbol: RH128380
Previously known as: AA899657; 
RGD ID: 5025454
Expected Size: 217 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21387,757,988 - 87,758,205 (+)MAPPERmRatBN7.2
mRatBN7.2186,775,464 - 86,775,681 (-)MAPPERmRatBN7.2
mRatBN7.2186,775,464 - 86,775,681 (+)MAPPERmRatBN7.2
mRatBN7.21387,757,988 - 87,758,205 (-)MAPPERmRatBN7.2
Rnor_6.01393,884,870 - 93,885,086NCBIRnor6.0
Rnor_6.0190,010,900 - 90,011,116NCBIRnor6.0
Rnor_5.0191,155,457 - 91,155,673UniSTSRnor5.0
Rnor_5.01398,349,138 - 98,349,354UniSTSRnor5.0
RGSC_v3.4186,605,631 - 86,605,847UniSTSRGSC3.4
RGSC_v3.41391,567,396 - 91,567,612UniSTSRGSC3.4
Celera1387,349,714 - 87,349,930UniSTS
Celera181,141,819 - 81,142,035UniSTS
Cytogenetic Map13q25UniSTS
Cytogenetic Map1q21UniSTS
Is Marker For: Genes:   Uba2   Uba2-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCATAGCACTTGACACTTCTGTGA
Reverse Primer AGTGATGAGCTGAAAGAATGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1561353Uba2-ps1ubiquitin-like modifier activating enzyme 2, pseudogene 1138775579687758435Rat
1312023Uba2ubiquitin-like modifier activating enzyme 218677523986802685Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
12879444Bp397Blood pressure QTL 397arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134504940490049404Rat
12879471Bp398Blood pressure QTL 398arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134551471990514719Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134569998390699983Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)135236217197362171Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1356056920101056920Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
8655959Pur32Proteinuria QTL 328.4urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)137402391897213863Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1374862117101339893Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1380753256106807694Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
61433Cia2Collagen induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)17843075491209302Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)180592172125592172Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)182174743118944897Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)183547917128547917Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)185424647100358001Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 308508 UniSTS
  498290 UniSTS
UniSTS 211688 UniSTS