Marker: D19Got53 |
| Symbol: |
D19Got53 |
| Previously known as: |
OT44.18; oxsts1513;
|
| RGD ID: |
45657 |
| Expected Size: |
202 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 19 | 46,863,392 - 46,863,594 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 19 | 51,448,264 - 51,448,465 | NCBI | Rnor6.0 | Rnor_5.0 | 19 | 62,204,148 - 62,204,349 | UniSTS | Rnor5.0 | RGSC_v3.4 | 19 | 49,122,393 - 49,122,595 | RGD | RGSC3.4 | RGSC_v3.4 | 19 | 49,122,394 - 49,122,595 | UniSTS | RGSC3.4 | RGSC_v3.1 | 19 | 49,127,275 - 49,127,476 | RGD | | Celera | 19 | 46,125,257 - 46,125,458 | UniSTS | | RH 3.4 Map | 19 | 612.6 | UniSTS | | RH 3.4 Map | 19 | 612.6 | RGD | | RH 2.0 Map | 19 | 644.1 | RGD | | Cytogenetic Map | 19 | q12 | UniSTS | |
|
| Is Marker For: |
Genes:
Cdh13
|
Annotation
References - curated
| # |
Reference Title |
Reference Citation |
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
| 3. |
UniSTS Pipeline |
RGD automated pipelines
|
| 4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
| |
| Forward Primer |
CACAGGCTGCCTGATATCTTT |
| Reverse Primer |
AATTTAAGTCAGTTCCTGTGAGGTG |
| |
Region
Genes in Region
| 619745 | Cdh13 | cadherin 13 | 19 | 46349562 | 47387462 | Rat | |
QTLs in Region (mRatBN7.2)
| 724566 | Uae12 | Urinary albumin excretion QTL 12 | 5 | | urine albumin amount (VT:0002871) | urine albumin level (CMO:0000130) | 19 | 2187927 | 56457239 | Rat | | 61447 | Tcas1 | Tongue tumor susceptibility QTL 1 | 6.08 | | tongue integrity trait (VT:0010553) | squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875) | 19 | 2316121 | 47316121 | Rat | | 2317848 | Alcrsp21 | Alcohol response QTL 21 | 1.899999976158142 | 0.05 | response to alcohol trait (VT:0010489) | duration of loss of righting reflex (CMO:0002289) | 19 | 3204777 | 48204777 | Rat | | 1331737 | Uae29 | Urinary albumin excretion QTL 29 | 5.5 | | urine albumin amount (VT:0002871) | urine albumin level (CMO:0000130) | 19 | 4096155 | 55283277 | Rat | | 7411549 | Bw130 | Body weight QTL 130 | 5 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 19 | 15455860 | 57337602 | Rat | | 1578764 | Stresp19 | Stress response QTL 19 | 3.6 | 0.001 | blood renin amount (VT:0003349) | plasma renin activity level (CMO:0000116) | 19 | 15630201 | 57337602 | Rat | | 2298478 | Eau8 | Experimental allergic uveoretinitis QTL 8 | | 0.0163 | uvea integrity trait (VT:0010551) | experimental autoimmune uveitis score (CMO:0001504) | 19 | 17154433 | 57337602 | Rat | | 61350 | Bp32 | Blood pressure QTL 32 | | 0.012 | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 19 | 20483575 | 57337602 | Rat | | 724546 | Kidm3 | Kidney mass QTL 3 | 3.1 | | kidney mass (VT:0002707) | calculated kidney weight (CMO:0000160) | 19 | 29322490 | 57337602 | Rat | | 1358200 | Insglur2 | Insulin/glucose ratio QTL 2 | 4.1 | | blood glucose amount (VT:0000188) | serum insulin level (CMO:0000358) | 19 | 33838214 | 55283146 | Rat | | 1358200 | Insglur2 | Insulin/glucose ratio QTL 2 | 4.1 | | blood glucose amount (VT:0000188) | serum glucose level (CMO:0000543) | 19 | 33838214 | 55283146 | Rat | | 5135224 | Leukc1 | Leukocyte quantity QTL 1 | | | eosinophil quantity (VT:0002602) | blood eosinophil count (CMO:0000033) | 19 | 44340214 | 55283277 | Rat | |
