D18Got7 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Got7

Symbol: D18Got7
Previously known as: OT77.17; oxsts1450; 
RGD ID: 45583
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0186,846,985 - 6,847,139NCBIRnor6.0
Rnor_5.0186,803,625 - 6,803,779UniSTSRnor5.0
RGSC_v3.4186,712,370 - 6,712,525RGDRGSC3.4
RGSC_v3.4186,712,371 - 6,712,525UniSTSRGSC3.4
RGSC_v3.1186,712,371 - 6,712,525RGD
Celera186,610,600 - 6,610,733UniSTS
RH 3.4 Map1868.5UniSTS
RH 3.4 Map1868.5RGD
RH 2.0 Map18790.2RGD
Cytogenetic Map18p13UniSTS
Is Marker For: Genes:   Chst9  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CATGGTGTGAGGTGTTGGTTT
Reverse Primer TAGCTACACTCCCATTGGAAGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU026857 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 291770 UniSTS
UniSTS 113868 UniSTS