Marker: D17Got104 |
| Symbol: |
D17Got104 |
| Previously known as: |
OT34.27; oxsts1296;
|
| RGD ID: |
45517 |
| Expected Size: |
208 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 17 | 83,401,813 - 83,402,021 (+) | MAPPER | mRatBN7.2 | mRatBN7.2 | 17 | 83,401,813 - 83,402,199 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 17 | 87,778,558 - 87,779,021 | NCBI | Rnor6.0 | Rnor_6.0 | 17 | 87,778,558 - 87,778,765 | NCBI | Rnor6.0 | Rnor_5.0 | 17 | 89,467,667 - 89,467,874 | UniSTS | Rnor5.0 | Rnor_5.0 | 17 | 89,467,667 - 89,468,130 | UniSTS | Rnor5.0 | RGSC_v3.4 | 17 | 94,870,697 - 94,870,904 | UniSTS | RGSC3.4 | RGSC_v3.4 | 17 | 94,870,696 - 94,870,904 | RGD | RGSC3.4 | RGSC_v3.1 | 17 | 94,881,530 - 94,881,737 | RGD | | Celera | 17 | 82,662,922 - 82,663,129 | UniSTS | | RH 3.4 Map | 17 | 872.1 | UniSTS | | RH 3.4 Map | 17 | 872.1 | RGD | | RH 2.0 Map | 17 | 725.2 | RGD | | Cytogenetic Map | 17 | q12.3 | UniSTS | |
|
| Is Marker For: |
Genes:
Arhgap21
|
Annotation
References - curated
| # |
Reference Title |
Reference Citation |
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
| 3. |
UniSTS Pipeline |
RGD automated pipelines
|
| 4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
| |
| Forward Primer |
GATCAAGCAGGTTGCATTTGT |
| Reverse Primer |
TCATGGCTTCTTTTTTCTTTGG |
| |
Region
Genes in Region
| 1311028 | Arhgap21 | Rho GTPase activating protein 21 | 17 | 83348673 | 83472202 | Rat | |
QTLs in Region (mRatBN7.2)
| 1358295 | Aocep1 | Aortic cell protein QTL 1 | 6.1 | 0.00000071 | thoracic aorta cellular protein amount (VT:0010598) | aortic cell percentage | 17 | 40990005 | 85990005 | Rat | | 7411575 | Bw140 | Body weight QTL 140 | 30.2 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 17 | 48560935 | 86533673 | Rat | | 8694181 | Bw151 | Body weight QTL 151 | 4.36 | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 17 | 48560935 | 86533673 | Rat | | 2317038 | Ginf3 | Gastrointestinal inflammation QTL 3 | 2.89 | 0.005 | liver integrity trait (VT:0010547) | liver granuloma severity score (CMO:0002157) | 17 | 49920154 | 86533673 | Rat | | 2303580 | Gluco49 | Glucose level QTL 49 | 2 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 17 | 50040271 | 86533673 | Rat | | 4889894 | Eae33 | Experimental allergic encephalomyelitis QTL 33 | 5.2 | 0.0001 | nervous system integrity trait (VT:0010566) | experimental autoimmune encephalomyelitis severity score (CMO:0001419) | 17 | 50909099 | 86022412 | Rat | | 2317045 | Aia11 | Adjuvant induced arthritis QTL 11 | 4.06 | | joint integrity trait (VT:0010548) | left rear ankle joint diameter (CMO:0002149) | 17 | 60781426 | 86533673 | Rat | | 7411577 | Bw141 | Body weight QTL 141 | | 0.001 | body mass (VT:0001259) | body weight gain (CMO:0000420) | 17 | 62619516 | 86533673 | Rat | |
