Marker: D15Got6 |
Symbol: |
D15Got6 |
Previously known as: |
OT05.07; oxsts1161;
|
RGD ID: |
45222 |
Expected Size: |
122 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 15 | 1,822,483 - 1,822,602 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 15 | 1,876,718 - 1,876,836 | NCBI | Rnor6.0 | Rnor_5.0 | 15 | 1,860,340 - 1,860,458 | UniSTS | Rnor5.0 | RGSC_v3.4 | 15 | 1,858,733 - 1,858,852 | RGD | RGSC3.4 | RGSC_v3.4 | 15 | 1,858,734 - 1,858,852 | UniSTS | RGSC3.4 | RGSC_v3.1 | 15 | 1,858,734 - 1,858,852 | RGD | | Celera | 15 | 2,754,561 - 2,754,679 | UniSTS | | RH 3.4 Map | 15 | 0.5 | UniSTS | | RH 3.4 Map | 15 | 0.5 | RGD | | RH 2.0 Map | 15 | 0.0 | RGD | | Cytogenetic Map | 15 | p16 | UniSTS | |
|
Is Marker For: |
Genes:
Lrmda
LOC100361239
|
Annotation
References - curated
# |
Reference Title |
Reference Citation |
1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
3. |
UniSTS Pipeline |
RGD automated pipelines
|
4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
TGGAAACTCCCAGGAGAAAA |
Reverse Primer |
CTGTTACTCCAGCTTCCTGGG |
|
Region
Genes in Region
1596707 | Lrmda | leucine rich melanocyte differentiation associated | 15 | 1223098 | 2284764 | Rat | |
QTLs in Region (mRatBN7.2)
1354657 | Despr13 | Despair related QTL 13 | | 0.0022 | locomotor behavior trait (VT:0001392) | amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) | 15 | 1 | 29912054 | Rat | 8552920 | Pigfal8 | Plasma insulin-like growth factor 1 level QTL 8 | 3 | | blood insulin-like growth factor amount (VT:0010479) | plasma insulin-like growth factor 1 level (CMO:0001299) | 15 | 1 | 34723002 | Rat | 8694361 | Abfw6 | Abdominal fat weight QTL 6 | 10.2 | 0.001 | visceral adipose mass (VT:0010063) | abdominal fat pad weight to body weight ratio (CMO:0000095) | 15 | 1 | 34723002 | Rat | 9589149 | Insul29 | Insulin level QTL 29 | 9.06 | 0.001 | blood insulin amount (VT:0001560) | plasma insulin level (CMO:0000342) | 15 | 1 | 34723002 | Rat | 731170 | Pur3 | Proteinuria QTL 3 | 2.3 | 0.0005 | urine protein amount (VT:0005160) | urine protein excretion rate (CMO:0000759) | 15 | 1 | 41686771 | Rat | 1641887 | Alcrsp14 | Alcohol response QTL 14 | | | response to alcohol trait (VT:0010489) | brain neurotensin receptor 1 density (CMO:0002068) | 15 | 1 | 42356671 | Rat | 2298549 | Neuinf12 | Neuroinflammation QTL 12 | 3.5 | | nervous system integrity trait (VT:0010566) | spinal cord beta-2 microglobulin mRNA level (CMO:0002125) | 15 | 1 | 55302115 | Rat | 10401805 | Kidm51 | Kidney mass QTL 51 | | | kidney mass (VT:0002707) | both kidneys wet weight (CMO:0000085) | 15 | 306329 | 45306329 | Rat | 5684946 | Bss98 | Bone structure and strength QTL 98 | 3.9 | 0.0026 | tibia strength trait (VT:1000284) | tibia ultimate force (CMO:0001734) | 15 | 1058250 | 14481294 | Rat | |