D15Got6 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D15Got6

Symbol: D15Got6
Previously known as: OT05.07; oxsts1161; 
RGD ID: 45222
Expected Size: 122 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2151,822,483 - 1,822,602 (+)MAPPERmRatBN7.2
Rnor_6.0151,876,718 - 1,876,836NCBIRnor6.0
Rnor_5.0151,860,340 - 1,860,458UniSTSRnor5.0
RGSC_v3.4151,858,733 - 1,858,852RGDRGSC3.4
RGSC_v3.4151,858,734 - 1,858,852UniSTSRGSC3.4
RGSC_v3.1151,858,734 - 1,858,852RGD
Celera152,754,561 - 2,754,679UniSTS
RH 3.4 Map150.5UniSTS
RH 3.4 Map150.5RGD
RH 2.0 Map150.0RGD
Cytogenetic Map15p16UniSTS
Is Marker For: Genes:   Lrmda   LOC100361239  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGGAAACTCCCAGGAGAAAA
Reverse Primer CTGTTACTCCAGCTTCCTGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596707Lrmdaleucine rich melanocyte differentiation associated1512230982284764Rat

Nucleotide Sequences
GenBank Nucleotide AU028666 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU028861 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354657Despr13Despair related QTL 130.0022locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)15129912054Rat
8552920Pigfal8Plasma insulin-like growth factor 1 level QTL 83blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)15134723002Rat
8694361Abfw6Abdominal fat weight QTL 610.20.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)15134723002Rat
9589149Insul29Insulin level QTL 299.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)15134723002Rat
731170Pur3Proteinuria QTL 32.30.0005urine protein amount (VT:0005160)urine protein excretion rate (CMO:0000759)15141686771Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15142356671Rat
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)15155302115Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1530632945306329Rat
5684946Bss98Bone structure and strength QTL 983.90.0026tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)15105825014481294Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100361239 UniSTS
  681383 UniSTS
UniSTS 112105 UniSTS