D14Got36 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D14Got36

Symbol: D14Got36
Previously known as: OT48.29; oxsts331; 
RGD ID: 45170
Expected Size: 122 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21428,206,830 - 28,206,952 (+)MAPPERmRatBN7.2
Rnor_6.01430,415,941 - 30,416,062NCBIRnor6.0
Rnor_5.01430,228,870 - 30,228,991UniSTSRnor5.0
RGSC_v3.41430,261,861 - 30,261,983RGDRGSC3.4
RGSC_v3.41430,261,862 - 30,261,983UniSTSRGSC3.4
RGSC_v3.11430,261,861 - 30,261,983RGD
Celera1427,558,991 - 27,559,112UniSTS
RH 3.4 Map14360.7UniSTS
RH 3.4 Map14360.7RGD
RH 2.0 Map14342.6RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TTCTCTACAGCCTGAAGGAAAAG
Reverse Primer CCGATATTCAAATGCATGAGTCTA
 

Region

Nucleotide Sequences
GenBank Nucleotide AU026511 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14381307430767156Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14908897839057237Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
631212Bw5Body weight QTL55.43retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)141103081230320092Rat
1300140Srn3Serum renin concentration QTL 33.19blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)141487516830883947Rat
71117Niddm17Non-insulin dependent diabetes mellitus QTL 172.35blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)141759376142336881Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141762256142337007Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141854133263541332Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)141863134542337007Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat


Additional Information

Database Acc Id Source(s)
UniSTS 114209 UniSTS