Marker: D14Got1 |
| Symbol: |
D14Got1 |
| Previously known as: |
OT23.22; oxsts1022;
|
| RGD ID: |
45137 |
| Expected Size: |
204 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 14 | 938,989 - 939,187 (+) | MAPPER | mRatBN7.2 | mRatBN7.2 | 14 | 938,989 - 939,366 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 14 | 1,949,012 - 1,949,438 | NCBI | Rnor6.0 | Rnor_6.0 | 14 | 1,949,012 - 1,949,209 | NCBI | Rnor6.0 | Rnor_5.0 | 14 | 1,944,738 - 1,945,164 | UniSTS | Rnor5.0 | Rnor_5.0 | 14 | 1,944,738 - 1,944,935 | UniSTS | Rnor5.0 | RGSC_v3.4 | 14 | 1,479,488 - 1,479,686 | RGD | RGSC3.4 | RGSC_v3.4 | 14 | 1,479,489 - 1,479,686 | UniSTS | RGSC3.4 | RGSC_v3.1 | 14 | 1,479,488 - 1,479,686 | RGD | | Celera | 14 | 977,833 - 978,025 | UniSTS | | RH 2.0 Map | 14 | 9.8 | RGD | | Cytogenetic Map | 14 | p22 | UniSTS | |
|
| Is Marker For: |
Genes:
Tmed11
|
Annotation
References - curated
| # |
Reference Title |
Reference Citation |
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
UniSTS Pipeline |
RGD automated pipelines
|
| 3. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 4. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
| |
| Forward Primer |
CCATGTTAGCCAATGTAGTATTCA |
| Reverse Primer |
CATGGTATCAACCCTATGCATGTA |
| |
Region
Genes in Region
| 1588776 | Tmed11 | transmembrane emp24 protein transport domain containing 11 | 14 | 926983 | 947574 | Rat | |
QTLs in Region (mRatBN7.2)
| 2300159 | Bmd61 | Bone mineral density QTL 61 | 5.3 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 14 | 1 | 26541967 | Rat | | 2300183 | Bmd60 | Bone mineral density QTL 60 | 5.7 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 14 | 1 | 26541967 | Rat | | 619619 | Rf4 | Renal disease susceptibility QTL 4 | 4.1 | 0.002 | urine total protein amount (VT:0000032) | urine protein excretion rate to body weight ratio (CMO:0001099) | 14 | 1 | 32754612 | Rat | | 634352 | Apr6 | Acute phase response QTL 6 | 3.7 | | blood interleukin-6 amount (VT:0008595) | plasma interleukin-6 level (CMO:0001927) | 14 | 1 | 41131407 | Rat | |
