Marker: D14Got2 |
| Symbol: |
D14Got2 |
| Previously known as: |
OT71.26; oxsts322;
|
| RGD ID: |
45136 |
| Expected Size: |
173 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 14 | 1,241,910 - 1,242,083 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 14 | 2,252,122 - 2,252,294 | NCBI | Rnor6.0 | Rnor_5.0 | 14 | 2,246,750 - 2,246,922 | UniSTS | Rnor5.0 | RGSC_v3.4 | 14 | 1,788,683 - 1,788,856 | RGD | RGSC3.4 | RGSC_v3.4 | 14 | 1,788,684 - 1,788,856 | UniSTS | RGSC3.4 | RGSC_v3.1 | 14 | 1,788,683 - 1,788,856 | RGD | | Celera | 14 | 1,281,259 - 1,281,431 | UniSTS | | RH 2.0 Map | 14 | 7.8 | RGD | | Cytogenetic Map | 14 | p22 | UniSTS | |
|
| Is Marker For: |
Genes:
Pcgf3
|
Annotation
References - curated
| # |
Reference Title |
Reference Citation |
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
UniSTS Pipeline |
RGD automated pipelines
|
| 3. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 4. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
| |
| Forward Primer |
AAGCCCAAAGGTTGCAGG |
| Reverse Primer |
GCATGTGGGTGAAACATTCATTA |
| |
Region
Genes in Region
| 1311479 | Pcgf3 | polycomb group ring finger 3 | 14 | 1237594 | 1291717 | Rat | |
QTLs in Region (mRatBN7.2)
| 2300159 | Bmd61 | Bone mineral density QTL 61 | 5.3 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 14 | 1 | 26541967 | Rat | | 2300183 | Bmd60 | Bone mineral density QTL 60 | 5.7 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 14 | 1 | 26541967 | Rat | | 619619 | Rf4 | Renal disease susceptibility QTL 4 | 4.1 | 0.002 | urine total protein amount (VT:0000032) | urine protein excretion rate to body weight ratio (CMO:0001099) | 14 | 1 | 32754612 | Rat | | 634352 | Apr6 | Acute phase response QTL 6 | 3.7 | | blood interleukin-6 amount (VT:0008595) | plasma interleukin-6 level (CMO:0001927) | 14 | 1 | 41131407 | Rat | | 71115 | Niddm15 | Non-insulin dependent diabetes mellitus QTL 15 | 4.8 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | 14 | 1217606 | 11030812 | Rat | | 70204 | Niddm20 | Non-insulin dependent diabetes mellitus QTL 20 | 5.1 | 0.000008 | blood glucose amount (VT:0000188) | blood glucose level area under curve (AUC) (CMO:0000350) | 14 | 1217606 | 16960180 | Rat | |
