D6Got23 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D6Got23

Symbol: D6Got23
Previously known as: OT43.17; oxsts2309; 
RGD ID: 44044
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2628,422,966 - 28,423,183 (+)MAPPERmRatBN7.2
Rnor_6.0629,515,794 - 29,516,008NCBIRnor6.0
Rnor_5.0640,371,531 - 40,371,745UniSTSRnor5.0
RGSC_v3.4628,737,729 - 28,737,944RGDRGSC3.4
RGSC_v3.4628,737,730 - 28,737,944UniSTSRGSC3.4
RGSC_v3.1628,740,683 - 28,740,897RGD
Celera627,889,370 - 27,889,584UniSTS
RH 3.4 Map6119.38UniSTS
RH 3.4 Map6119.38RGD
RH 2.0 Map6232.5RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TCCTTCCCTCTCTCCCTCCT
Reverse Primer TCTTGCTGAACCTCCAGAATG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
9118293LOC103692581uncharacterized LOC10369258162839075528432893Rat
41399269LOC120103501uncharacterized LOC12010350162840401628424608Rat

Nucleotide Sequences
GenBank Nucleotide AU025263 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331743Uae28Urinary albumin excretion QTL 284.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)6134235784Rat
1578758Tcas9Tongue tumor susceptibility QTL 93.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)6137618905Rat
1598843Cm63Cardiac mass QTL 632.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)6139036266Rat
7411603Foco13Food consumption QTL 135.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6141223769Rat
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6141223769Rat
7411542Bw127Body weight QTL 1275.50.001body mass (VT:0001259)body weight gain (CMO:0000420)6141223769Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6141223769Rat
9589048Scfw3Subcutaneous fat weight QTL 34.570.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)6141223769Rat
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6142487980Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6142487980Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6142487980Rat
7411584Foco4Food consumption QTL 44.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6142838846Rat
738024Sach5Saccharine consumption QTL 53.90.00039consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)6143394190Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
1300128Rf16Renal function QTL 163.89renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449734434305Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat


Additional Information

Database Acc Id Source(s)
UniSTS 115434 UniSTS