DXGot56 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXGot56

Symbol: DXGot56
Previously known as: oxsts2822; OT86.39; 
RGD ID: 43950
Expected Size: 163 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X121,375,172 - 121,375,335 (+)MAPPERmRatBN7.2
Rnor_6.0X128,898,661 - 128,898,823NCBIRnor6.0
Rnor_5.0X128,980,298 - 128,980,460UniSTSRnor5.0
RGSC_v3.4X2,558,881 - 2,559,044RGDRGSC3.4
RGSC_v3.4X2,558,882 - 2,559,044UniSTSRGSC3.4
RGSC_v3.1X2,558,881 - 2,559,044RGD
CeleraX120,488,175 - 120,488,337UniSTS
RH 2.0 Map5738.3RGD
Cytogenetic MapXq11UniSTS
Is Marker For: Genes:   Sh2d1a  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GGAAGTCTCCAGAAGGACCC
Reverse Primer AACTCACTACCAAGCACTGTTTTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562408Sh2d1aSH2 domain containing 1AX121373693121401923Rat

Nucleotide Sequences
GenBank Nucleotide AU027165 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X93956491138956491Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX100567703150256146Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X103312877148312877Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X103312877148312877Rat
738029Stresp2Stress response QTL 23.40.0004stress-related behavior trait (VT:0010451)defensive burying - approachX112934952138400867Rat
5685004Bss104Bone structure and strength QTL 1043.9tibia area (VT:1000281)tibia area measurement (CMO:0001382)X113805422126975220Rat
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X113937816152453651Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 501502 UniSTS
UniSTS 113573 UniSTS