Marker: DXGot56 |
Symbol: |
DXGot56 |
Previously known as: |
oxsts2822; OT86.39;
|
RGD ID: |
43950 |
Expected Size: |
163 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | X | 121,375,172 - 121,375,335 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | X | 128,898,661 - 128,898,823 | NCBI | Rnor6.0 | Rnor_5.0 | X | 128,980,298 - 128,980,460 | UniSTS | Rnor5.0 | RGSC_v3.4 | X | 2,558,881 - 2,559,044 | RGD | RGSC3.4 | RGSC_v3.4 | X | 2,558,882 - 2,559,044 | UniSTS | RGSC3.4 | RGSC_v3.1 | X | 2,558,881 - 2,559,044 | RGD | | Celera | X | 120,488,175 - 120,488,337 | UniSTS | | RH 2.0 Map | 5 | 738.3 | RGD | | Cytogenetic Map | X | q11 | UniSTS | |
|
Is Marker For: |
Genes:
Sh2d1a
|
Annotation
References - curated
# |
Reference Title |
Reference Citation |
1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
UniSTS Pipeline |
RGD automated pipelines
|
3. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
4. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
GGAAGTCTCCAGAAGGACCC |
Reverse Primer |
AACTCACTACCAAGCACTGTTTTG |
|
Region
Genes in Region
1562408 | Sh2d1a | SH2 domain containing 1A | X | 121373693 | 121401923 | Rat | |
QTLs in Region (mRatBN7.2)
1598837 | Memor13 | Memory QTL 13 | 3.2 | | exploratory behavior trait (VT:0010471) | difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) | X | 41052407 | 146860749 | Rat | 1598872 | Memor14 | Memory QTL 14 | 4.5 | | exploratory behavior trait (VT:0010471) | difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) | X | 93956491 | 138956491 | Rat | 738025 | Stresp3 | Stress response QTL 3 | 4.61 | 0.0066 | stress-related behavior trait (VT:0010451) | defensive burying - approach | X | 100567703 | 150256146 | Rat | 1598809 | Memor15 | Memory QTL 15 | 4.4 | | exploratory behavior trait (VT:0010471) | difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) | X | 103312877 | 148312877 | Rat | 1598856 | Memor1 | Memory QTL 1 | 1.9 | | exploratory behavior trait (VT:0010471) | total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) | X | 103312877 | 148312877 | Rat | 738029 | Stresp2 | Stress response QTL 2 | 3.4 | 0.0004 | stress-related behavior trait (VT:0010451) | defensive burying - approach | X | 112934952 | 138400867 | Rat | 5685004 | Bss104 | Bone structure and strength QTL 104 | 3.9 | | tibia area (VT:1000281) | tibia area measurement (CMO:0001382) | X | 113805422 | 126975220 | Rat | 10059603 | Bw174 | Body weight QTL 174 | 3.4 | 0.025 | body mass (VT:0001259) | body weight (CMO:0000012) | X | 113937816 | 152453651 | Rat | |