D1Got271 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D1Got271

Symbol: D1Got271
Previously known as: OT66.12; oxsts1562; 
RGD ID: 43455
Expected Size: 273 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21259,183,872 - 259,184,144 (+)MAPPERmRatBN7.2
Rnor_6.01281,192,087 - 281,192,358NCBIRnor6.0
Rnor_5.01288,548,756 - 288,549,027UniSTSRnor5.0
RGSC_v3.41266,588,833 - 266,589,105RGDRGSC3.4
RGSC_v3.41266,588,834 - 266,589,105UniSTSRGSC3.4
RGSC_v3.11266,799,879 - 266,800,150RGD
Celera1254,831,689 - 254,831,960UniSTS
RH 3.4 Map11706.8UniSTS
RH 3.4 Map11706.8RGD
RH 2.0 Map11310.9999RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GCTGTTCCAGAGTCCTCGAA
Reverse Primer TATAACTCCAGCTCTGTCAGGTCC
 

Region



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
1581544Rf52Renal function QTL 520.05urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1236125214260522016Rat
631836Stl31Serum triglyceride level QTL 314.640.00000487blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1237147813260522016Rat
631837Niddm35Non-insulin dependent diabetes mellitus QTL 350.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1238699859259647894Rat
737975Bw122Body weight QTL 1229.110.005body mass (VT:0001259)body weight (CMO:0000012)1258843780260122809Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112763 UniSTS