D1Got210 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D1Got210

Symbol: D1Got210
Previously known as: oxsts92; OT68.29; 
RGD ID: 43420
Expected Size: 297 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X152,163,580 - 152,163,877 (-)MAPPERmRatBN7.2
Rnor_6.0X156,331,137 - 156,331,433NCBIRnor6.0
Rnor_5.01152,071,274 - 152,071,570UniSTSRnor5.0
RGSC_v3.4X160,229,517 - 160,229,814RGDRGSC3.4
RGSC_v3.4X160,229,518 - 160,229,814UniSTSRGSC3.4
RGSC_v3.1X160,305,135 - 160,305,432RGD
Celera1135,732,780 - 135,733,076UniSTS
RH 2.0 Map11181.3RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CAGACAGCCTTGCCATAACAGT
Reverse Primer CTGGAACTGAAGTTACAGAGCAGTC
 

Region

Nucleotide Sequences
GenBank Nucleotide AC094668 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU028429 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X113937816152453651Rat
634346Insul4Insulin level QTL 40blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)X126975089152453651Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112337 UniSTS