D1Got57 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Got57

Symbol: D1Got57
Previously known as: OT79.14; oxsts1603; 
RGD ID: 43221
Expected Size: 144 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2147,611,206 - 47,611,350 (+)MAPPERmRatBN7.2
Rnor_6.0147,886,984 - 47,887,127NCBIRnor6.0
Rnor_5.0151,862,085 - 51,862,228UniSTSRnor5.0
RGSC_v3.4141,835,441 - 41,835,585RGDRGSC3.4
RGSC_v3.4141,835,442 - 41,835,585UniSTSRGSC3.4
RGSC_v3.1141,838,386 - 41,838,530RGD
Celera143,296,198 - 43,296,341UniSTS
RH 2.0 Map1292.0RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGCGCACCTCTCTCTCTTTTA
Reverse Primer TGCCTTAGGTTTTGTTTGGTTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU025733 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
5684998Bss101Bone structure and strength QTL 1013.6tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)11543162149361612Rat
5684999Bss102Bone structure and strength QTL 1025.50.00000072tibia strength trait (VT:1000284)tibia stiffness (CMO:0001735)11543162149361612Rat
738020Pia8Pristane induced arthritis QTL 84.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1165833076Rat
631494Bp95Blood pressure QTL 95400.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)11620621049268520Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
631508Sald1Serum aldosterone level QTL 13.7blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)1985600154856001Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1439328949393289Rat
634353Rends2Renal damage susceptibility QTL 20.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)11933357156983283Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11148131275088344Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)13523959878430678Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14580314078430678Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)12887978078430678Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)13523959878430678Rat
1357400Bw62Body weight QTL624.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)12234064767340647Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)13344984878449848Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)13344984878449848Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
1578756Iddm22Insulin dependent diabetes mellitus QTL 222.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)11183518156835181Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
724520Bp145Blood pressure QTL 1452.10.0024arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12078482865784828Rat
2302038Pia31Pristane induced arthritis QTL 315.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)11099206555992065Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
1357397Bw41Body weight QTL 414.190.0001body mass (VT:0001259)body weight (CMO:0000012)12234064749361612Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
1357401Bw43Body weight QTL 433.75body mass (VT:0001259)body weight (CMO:0000012)12234064749361612Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)13483685879836858Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat


Additional Information

Database Acc Id Source(s)
UniSTS 114974 UniSTS