D19Rat103 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D19Rat103

Symbol: D19Rat103
Previously known as: R0324-B01; oxsts10008; 
RGD ID: 43137
Expected Size: 149 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21951,607,691 - 51,607,842 (+)MAPPERmRatBN7.2
mRatBN7.21951,585,915 - 51,586,064 (+)MAPPERmRatBN7.2
mRatBN7.21951,590,089 - 51,590,238 (+)MAPPERmRatBN7.2
mRatBN7.21951,591,849 - 51,591,998 (+)MAPPERmRatBN7.2
mRatBN7.21951,595,373 - 51,595,522 (+)MAPPERmRatBN7.2
mRatBN7.21951,598,895 - 51,599,044 (+)MAPPERmRatBN7.2
mRatBN7.25139,780,068 - 139,780,099 (-)MAPPERmRatBN7.2
mRatBN7.27127,189,592 - 127,189,623 (-)MAPPERmRatBN7.2
mRatBN7.21951,582,400 - 51,582,551 (+)MAPPERmRatBN7.2
mRatBN7.21951,580,643 - 51,580,794 (+)MAPPERmRatBN7.2
mRatBN7.21951,577,123 - 51,577,272 (+)MAPPERmRatBN7.2
mRatBN7.21951,602,417 - 51,602,568 (+)MAPPERmRatBN7.2
mRatBN7.21951,597,133 - 51,597,284 (+)MAPPERmRatBN7.2
mRatBN7.21951,605,937 - 51,606,086 (+)MAPPERmRatBN7.2
mRatBN7.21951,600,655 - 51,600,804 (+)MAPPERmRatBN7.2
Rnor_6.01956,338,110 - 56,338,267NCBIRnor6.0
Celera1950,804,940 - 50,805,083UniSTS
RH 3.4 Map19750.5UniSTS
RH 3.4 Map19750.5RGD
RH 2.0 Map19727.7RGD
SHRSP x BN Map1944.9198RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer ATAAGCAGGCACGGAACCTA
Reverse Primer CTCCTGCGAGAGTCTGTGTG
 
Template 
GATCCCCCCCCCTAGGGCGCATAAGCAGGCACGGAACCTAAGGACAGCTCACAAACACACACAC
ACACACACACACACACAGATACACTCAGTCACACACACACACTCAATCACACACACACTCACTC
ACACACTCACACACTCACTCACACACAGACTCTCGCAGGAGTCACCTTAGCAGGAGGCAGGAGG
GGGAGCGACACACACTCTCACACCGGTGGGGTACCGAGCTCGAATTACGTAATCATGGTCATAG
NTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGGCCGGAAGCATA
AAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGC
CCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAG
AGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTG
ATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGC
AGGCGAAAATCCTGTTTGATGGTGGTTTCGAAATCGGCAAATCCCTTATAAATCAAAGATAGCC
NNGATAGNGTTGAGTGTGTTCANTTGGAANGNNCNTNTAAAGAANTGGNTCCACGTCANGGNNA
AANNNTANNGGGANNNCNTAGTANNACACCAATAAGTTTNNGGGTGG

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41093667LOC1200987185S ribosomal RNA195160303751603155Rat
41264674LOC1200986725S ribosomal RNA195158477351584891Rat
41366977LOC1200987485S ribosomal RNA195158302051583138Rat
41190846LOC1200987115S ribosomal RNA195159246751592585Rat
41367669Rna5s7RNA, 5S ribosomal 7195159951351599631Rat
41162948LOC1200987175S ribosomal RNA195157774151577859Rat
41011831LOC1200987195S ribosomal RNA195160479551604913Rat
40984105Rna5s13RNA, 5S ribosomal 13195158126351581381Rat
41226032LOC1200987125S ribosomal RNA195159423151594349Rat
41016926LOC1200987165S ribosomal RNA195160127351601391Rat
41019155Rna5s6RNA, 5S ribosomal 6195157950151579619Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
1354582Stl11Serum triglyceride level QTL 113.42blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7119513385135012528Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum insulin level (CMO:0000358)193383821455283146Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat
5135224Leukc1Leukocyte quantity QTL 1eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)194434021455283277Rat
2313395Anxrr26Anxiety related response QTL 26aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)194997648153225766Rat


Additional Information

Database Acc Id Source(s)
UniSTS 226965 UniSTS