D6Arb19 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D6Arb19

Symbol: D6Arb19
Previously known as: D6Arb54; R0267-B06; oxsts7926; 
RGD ID: 42194
Expected Size: 375 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.06130,700,836 - 130,701,210NCBIRnor6.0
Rnor_5.06139,872,868 - 139,873,242UniSTSRnor5.0
RGSC_v3.46131,173,916 - 131,174,290UniSTSRGSC3.4
RGSC_v3.46131,173,915 - 131,174,290RGDRGSC3.4
RGSC_v3.16131,177,663 - 131,178,037RGD
RH 3.4 Map6803.4UniSTS
RH 3.4 Map6803.4RGD
RH 2.0 Map61090.9RGD
SHRSP x BN Map680.5298RGD
Cytogenetic Map6 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AAGCTGCTTTCTTGTCCCCTCCTC
Reverse Primer CTAACCCTAGTCCAGAGCCTTCC
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Nucleotide L24378
  L24379
UniSTS 122177 UniSTS