D4Arb30 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Arb30

Symbol: D4Arb30
Previously known as: R0266-C03; oxsts7887; 
RGD ID: 42168
Expected Size: 205 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.4473,972,454 - 73,972,591UniSTSRGSC3.4
RGSC_v3.4473,972,453 - 73,972,591RGDRGSC3.4
RGSC_v3.1474,248,583 - 74,248,721RGD
Celera469,789,851 - 69,789,980UniSTS
RH 3.4 Map4465.4RGD
RH 3.4 Map4465.4UniSTS
RH 2.0 Map4512.0RGD
SHRSP x BN Map437.38RGD
FHH x ACI Map445.77RGD
Cytogenetic Map4q24UniSTS
Is Marker For: Strains:   DA.F344-(D4Arb30-D4Arb4)/Arb  
QTLs:   Scwia1   Aia2   Aia3  
Genes:   Cntnap2   LOC100364190  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Localization of quantitative trait loci regulating adjuvant-induced arthritis in rats: evidence for genetic factors common to multiple autoimmune diseases. Kawahito Y, etal., J Immunol 1998 Oct 15;161(8):4411-9
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
5. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
6. UniSTS Pipeline RGD automated pipelines
7. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
8. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
9. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database
10. Localization in rats of genetic loci regulating susceptibility to experimental erosive arthritis and related autoimmune diseases. Wilder RL, etal., Transplant Proc 1999 May;31(3):1585-8

Strains and Sequence

Sequence
 
Forward Primer ACTACCATAGAAAATGCTGG
Reverse Primer GATCCACTGCTCAAACACAT
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100364190 UniSTS
  326415 UniSTS
  326477 UniSTS
  326478 UniSTS
  500105 UniSTS
UniSTS 121913 UniSTS