D5Rat109 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D5Rat109

Symbol: D5Rat109
Previously known as: R0066-A12; oxsts11023; 
RGD ID: 38026
Expected Size: 249 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25163,581,702 - 163,581,951 (+)MAPPERmRatBN7.2
Rnor_6.05170,273,699 - 170,273,947NCBIRnor6.0
Rnor_5.05173,809,554 - 173,809,802UniSTSRnor5.0
Celera5161,802,374 - 161,802,622UniSTS
RH 3.4 Map51140.9UniSTS
RH 3.4 Map51140.9RGD
RH 2.0 Map51128.5RGD
FHH x ACI Map596.3999RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GGTGTGGTATGGTGCCTGTA
Reverse Primer CCACACATATGTGCACATAAACT
 
Template 
CATGCTGCAGGTCGACTCTAGAGGATCCCCCCTCTGGCACCTACACCCAGGAGTCCACACATAT
GTGCACATAAACTAAAAATAAATATATTGAGATGGAGAATGATTGATAAAAGACACCCAGGGTT
GACCTCAGGCTTCCACAGGCATGCACACCTACACACATACATGCACCCAGCATACTAACAAAGA
GGGAGAGAGACAGACAGACAGACACACACACACACACACACACACATAGAGATAAACAGACAGA
CAGACAAAGAAGGAGTATGTAGGTAAGTACAGGCACCATACCACACCAGAGCTCTTTTGTCGGA
CCACACTAATACGGGGTAACGNGNTTNNATTTCGTANCCATGGTCATAGCGGTTTCGTGTGTGA
AATTGTTATCCGCTCACAATTCCACACAANATACGAGCCGGAAGCATANAGTGTACAGCCTGGG
GTGCTAATGAGTGAGCTAACTCACATTATTGCGTTGNCTCACTGCCGCTTTCCAGTCGGGAAAC
TGTCGTGCCACTGCATTAATGAATCGGCACGCCGGGGAGAGGGGTTGGTATGGGCGCAGGTGGT
TTCTNCACAGTGAGAGGGACACTGATTGCTTCACGCTGNCTGAGAANTCNCAACGTCANTGTTC
CACAGNAACTGTTATGTGTCC

Region

Nucleotide Sequences
GenBank Nucleotide JH615323.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
1331721Bp210Blood pressure QTL 2103.413arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)5143069996166846814Rat
1354631Swd2Spike wave discharge measurement QTL 23.640.0002brain electrophysiology trait (VT:0010557)brain total spike-and-wave discharge duration (CMO:0001740)5151113452164465185Rat
631272Lanf1Left ventricular atrial natriuretic factor QTL 112heart left ventricle natriuretic peptide A amount (VT:0010596)heart left ventricle natriuretic peptide A level (CMO:0002165)5151113452166875058Rat
1549904Neuinf1Neuroinflammation QTL 130nervous system integrity trait (VT:0010566)blood T lymphocyte count (CMO:0000110)5154828214166875058Rat


Additional Information

Database Acc Id Source(s)
UniSTS 122079 UniSTS