D1Rat126 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Rat126

Symbol: D1Rat126
Previously known as: R0061-D09; oxsts6553; 
RGD ID: 37896
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21255,535,135 - 255,535,265 (+)MAPPERmRatBN7.2
Rnor_6.01277,301,397 - 277,301,526NCBIRnor6.0
Rnor_5.01284,682,354 - 284,682,483UniSTSRnor5.0
RGSC_v3.41262,779,963 - 262,780,092UniSTSRGSC3.4
RGSC_v3.41262,779,962 - 262,780,092RGDRGSC3.4
RGSC_v3.11262,991,008 - 262,991,137RGD
Celera1251,234,814 - 251,234,943UniSTS
RH 3.4 Map11681.6RGD
RH 3.4 Map11681.6UniSTS
RH 2.0 Map11305.9RGD
SHRSP x BN Map1143.5499RGD
FHH x ACI Map1132.5799RGD
Cytogenetic Map1q55UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Rpl19-ps2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGCATCCACACACACAAATG
Reverse Primer GGGTTGTGGAAGCAATCAAG
 
Template
ATGNTGCAGGTCGATCTAGAGGATCCCCCTTCAGGGTTGTGGAAGCAATCAAGGGTCAGTCTAA
ACTAGTTTTCATCACTGGCTCTAAGTTAAAAAAAAATTCTTCTTTCTAATGACCGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCATTTGTGTGTGTGGATGCAGTTATTTAC
ATGCTATGGTGGCTATGTGGCGGCCAGAAGGAAACCTTGGGTGTTGTCCTCAGCATCTGCCTTA
TTAGAGGCAGCAGGGTCTCCTGTTTGCTGCTGTGAGTTCCAGGCTAGGGGTACCGAGCTCGAAT
TCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACA
TACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAAT
TGCGTTGCGCTCACTGCCCGCTTTCCAGT

Region

Nucleotide Sequences
GenBank Nucleotide CH473986 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1218748008257976495Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1218753816256448513Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
1581544Rf52Renal function QTL 520.05urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1233190394258625266Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1236125214260522016Rat
631836Stl31Serum triglyceride level QTL 314.640.00000487blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1237147813260522016Rat
631837Niddm35Non-insulin dependent diabetes mellitus QTL 350.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1238699859259647894Rat
1598839Rf56Renal function QTL 56renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1245907761257976495Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 680527 UniSTS
UniSTS 118525 UniSTS