D5Rat44 Marker Search Result - Rat Genome Database

General

Marker: D5Rat44

Symbol:

D5Rat44

Previously known as:

R0037-C07; oxsts7207; R037-C07;

RGD ID:

36598

Expected Size:

158 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	5	152,400,282 - 152,400,440 (+)	MAPPER	mRatBN7.2
Rnor_6.0	5	158,621,076 - 158,621,233	NCBI	Rnor6.0
Rnor_5.0	5	162,341,507 - 162,341,664	UniSTS	Rnor5.0
RGSC_v3.4	5	159,007,429 - 159,007,587	RGD	RGSC3.4
RGSC_v3.4	5	159,007,430 - 159,007,587	UniSTS	RGSC3.4
RGSC_v3.1	5	159,017,618 - 159,017,775	RGD
Celera	5	150,767,938 - 150,768,095	UniSTS
RH 3.4 Map	5	1040.4	UniSTS
RH 3.4 Map	5	1040.4	RGD
SHRSP x BN Map	5	89.7999	UniSTS
SHRSP x BN Map	5	89.7999	RGD
FHH x ACI Map	5	85.32	RGD
Cytogenetic Map	5	q36	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OM/Ztm P5C PVG/Pit SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
Genes: Igsf21

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CTCCAGGCTGACCTGAAAAA
Reverse Primer	GCTTTGCAGCCATCTTTCTC

Strain Variation

Strain, Expected Size(s)

ACI/N	160
AVN/Orl	160
BBDP/Rhw	150
BBDR/Rhw	150
BC/CpbU	160
BDIX/Han	160
BDVII/Cub	158
BN-Lx/Cub	160
BN/SsNHsd	160
BP/Cub	144
BUF/Pit	160
COP/OlaHsd	160

DA/PitN	160
DON/Melb	160
F344/Pit	160
FHH/Eur	142
GH/Omr	162
GK/KyoSwe	160
IS/Kyo	160
LE/Mol	162
LEW/Pit	160
LH/Mav	160
LN/Mav	160
LOU/CHan	146

M520/N	160
MHS/Gib	148
MNR/N	160
MNRA/N	160
MNS/Gib	162
MR/Pit	160
NEDH/K	160
NP9	148
ODU/N	148
OM/Ztm	160
P5C	148
PVG/Pit	160

SHR/OlaHsd	148
SHRSP/Riv	148
SR/Jr	160
SS/Jr	160,148
WAG/RijKyo	160
WF/Pit	148
WIST/Nhg	160
WKY/OlaHsd	148
WN/N	156
WTC/Kyo	148

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1310117	Igsf21	immunoglobin superfamily, member 21	5	152287834	152512174	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473968	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000235	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1576314	Eutr1	Estrogen induced uterine response QTL 1			uterus integrity trait (VT:0010575)	pyometritis severity score (CMO:0002009)	5	2138965	166875058	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	46711509	161317411	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	60293434	161481680	Rat
1302790	Scl20	Serum cholesterol level QTL 20	6.4	0.0001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	82394392	166664054	Rat
1298089	Scl14	Serum cholesterol level QTL 14	5.8	0.0004	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	108845856	153845856	Rat
1598847	Cm62	Cardiac mass QTL 62	3.4		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	108845856	153845856	Rat
8657050	Bw146	Body weight QTL 146	19.84	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	108938288	153938288	Rat
8694441	Bw169	Body weight QTL 169	17.61	0.001	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	5	111416838	156416838	Rat
8694198	Abfw3	Abdominal fat weight QTL 3	16.13	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	5	111416838	156416838	Rat
8694389	Bw160	Body weight QTL 160	6.17	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	5	111416838	156416838	Rat
8552960	Pigfal15	Plasma insulin-like growth factor 1 level QTL 15			blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	5	111416838	156416838	Rat
1641920	Colcs1	Colorectal carcinoma susceptibility QTL 1	2.99	0.0055	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	5	121846814	166846814	Rat
10053720	Scort26	Serum corticosterone level QTL 26	2.06	0.0147	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	5	124965598	166875058	Rat
724525	Bp147	Blood pressure QTL 147	4.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	126424772	166875058	Rat
1598819	Bp292	Blood pressure QTL 292	4.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	127798274	166875058	Rat
1598861	Cm64	Cardiac mass QTL 64	2.9		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	127798274	166875058	Rat
8552908	Pigfal4	Plasma insulin-like growth factor 1 level QTL 4	6.6		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	5	128506074	166875058	Rat
8694169	Bw148	Body weight QTL 148	5	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	128506074	166875058	Rat
634349	Bp139	Blood pressure QTL 139		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	128924607	166875058	Rat
738018	Anxrr4	Anxiety related response QTL 4	5.1		exploratory behavior trait (VT:0010471)	percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)	5	130130159	166875058	Rat
7794791	Mcs33	Mammary carcinoma susceptibility QTL 33	1.93		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	5	131345754	166875058	Rat
631505	Bp103	Blood pressure QTL 103	3.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	132717196	165560427	Rat
631562	Apr2	Acute phase response QTL 2	3.7		blood murinoglobulin 1 amount (VT:0010597)	plasma murinoglobulin 1 level (CMO:0001931)	5	135927956	166875058	Rat
61444	Strs2	Sensitivity to stroke QTL 2	4.7		cerebrum integrity trait (VT:0010549)	post-insult time to onset of cerebrovascular lesion (CMO:0002343)	5	135929696	166875058	Rat
1331721	Bp210	Blood pressure QTL 210	3.413		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	5	143069996	166846814	Rat
2302369	Scl60	Serum cholesterol level QTL 60	3.13		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	143608201	161165651	Rat
631263	Cm24	Cardiac mass QTL 24	3.5		heart mass (VT:0007028)	heart left ventricle weight to body weight ratio (CMO:0000530)	5	143799107	158428037	Rat
1300119	Bp180	Blood pressure QTL 180	3.82		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	5	144358090	157869054	Rat
2313096	Bmd78	Bone mineral density QTL 78	3.1	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	5	144377876	161317411	Rat
1298090	Bp155	Blood pressure QTL 155	3.8		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	151006154	161165494	Rat
1354631	Swd2	Spike wave discharge measurement QTL 2	3.64	0.0002	brain electrophysiology trait (VT:0010557)	brain total spike-and-wave discharge duration (CMO:0001740)	5	151113452	164465185	Rat
631272	Lanf1	Left ventricular atrial natriuretic factor QTL 1	12		heart left ventricle natriuretic peptide A amount (VT:0010596)	heart left ventricle natriuretic peptide A level (CMO:0002165)	5	151113452	166875058	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	298591	UniSTS
UniSTS	118913	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D5Rat44