D10Rat18 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Rat18

Symbol: D10Rat18
Previously known as: R0029-B05; oxsts5932; R029-B05; 
RGD ID: 36019
Expected Size: 156 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21087,095,616 - 87,095,772 (+)MAPPERmRatBN7.2
Rnor_6.01090,082,847 - 90,083,002NCBIRnor6.0
Rnor_5.01089,870,212 - 89,870,367UniSTSRnor5.0
RGSC_v3.41091,208,778 - 91,208,933UniSTSRGSC3.4
RGSC_v3.41091,208,777 - 91,208,933RGDRGSC3.4
RGSC_v3.11091,223,148 - 91,223,303RGD
Celera1085,811,290 - 85,811,443UniSTS
RH 3.4 Map10882.8RGD
RH 3.4 Map10882.8UniSTS
RH 2.0 Map101005.3RGD
SHRSP x BN Map1066.5RGD
FHH x ACI Map1071.36RGD
Cytogenetic Map10q32.1UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   M520/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Anxrr22  
Genes:   Tmem101  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer AACTAGACAGGCGGTGCTGT
Reverse Primer CTCTGGAGGGTCCACATCAT
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102652195798952741Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14232313287323132Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104232313287323132Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104444169989441699Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104444169989441699Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104444169989441699Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104502965095600334Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104736947092369470Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
70364Bp72Blood pressure QTL 72arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105112110096121100Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1051770177107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)105177294096772940Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)105177461295600334Rat
631535Cm51Cardiac mass QTL 513heart mass (VT:0007028)calculated heart weight (CMO:0000073)105178628291669536Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
70164Bw21Body weight QTL 214.360.00005body mass (VT:0001259)body weight (CMO:0000012)105379749498952626Rat
1354608Cm33Cardiac mass QTL 332.8heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)105480929299809292Rat
2312662Slep8Serum leptin concentration QTL 80.05blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1057134272102134272Rat
2312668Scl65Serum cholesterol level QTL 650.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1057134272102134272Rat
2312672Insul15Insulin level QTL 150.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1057134272102134272Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1057576521102576521Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
2306970Anxrr22Anxiety related response QTL 225.95fear/anxiety-related behavior trait (VT:1000241)number of periods of voluntary immobility (CMO:0001045)106134527698211570Rat
6893336Cm75Cardiac mass QTL 750.10.87heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)106134527699703528Rat
1558643Cm44Cardiac mass QTL 444.80.0000368heart mass (VT:0007028)heart wet weight (CMO:0000069)106134527699703528Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
1357344Bp249Blood pressure QTL 2490.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106674365598003205Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
2306793Ean5Experimental allergic neuritis QTL 54.7nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)107255241693995749Rat
1358188Ept9Estrogen-induced pituitary tumorigenesis QTL 93.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107345313696120911Rat
2292617Ept18Estrogen-induced pituitary tumorigenesis QTL 183.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107345313696120911Rat
1579919Bp281Blood pressure QTL 2810.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107437208494965338Rat
10450495Bp383Blood pressure QTL 3830.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107624608594965338Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
1300107Rf18Renal function QTL 183.41urine output (VT:0003620)timed urine volume (CMO:0000260)107877551698279596Rat
1358915Stresp7Stress response QTL 73.52blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)107889965587307728Rat
631555Bp134Blood pressure QTL 1340.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)108051528791230079Rat
6893357Bw102Body weight QTL 1020.50.36body mass (VT:0001259)body weight (CMO:0000012)1080515287101325465Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
4889948Bss91Bone structure and strength QTL 914tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)108256485692369470Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
12880055Am11Aortic mass QTL 110.004aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)108400727295933025Rat
2301398Kidm38Kidney mass QTL 380.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)108400727295933025Rat
2306792Ean4Experimental allergic neuritis QTL 44nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)108402232193995963Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303131 UniSTS
  303564 UniSTS
UniSTS 118163 UniSTS