D4Rat10 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D4Rat10

Symbol: D4Rat10
Previously known as: R0027-B06; oxsts7021; R027-B06; 
RGD ID: 35913
Expected Size: 168 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2429,593,287 - 29,593,455 (+)MAPPERmRatBN7.2
Rnor_6.0426,753,655 - 26,753,822NCBIRnor6.0
Rnor_5.0426,659,360 - 26,659,527UniSTSRnor5.0
RGSC_v3.4426,280,781 - 26,280,949RGDRGSC3.4
RGSC_v3.4426,280,782 - 26,280,949UniSTSRGSC3.4
RGSC_v3.1426,296,677 - 26,297,121RGD
Celera425,025,212 - 25,025,379UniSTS
RH 2.0 Map4207.9RGD
SHRSP x BN Map411.3499RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   SHR.WKY-(D4Rat10-D4Rat15)/IzmTkyo   SHR.WKY-(D4Wox27-D4Rat10)/IzmTkyo   SHR.WKY-(D4Rat143-D4Rat10)/Tja  
QTLs:   Gluco12   Stl19  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TGCATTAGTCAGGGGTACAAA
Reverse Primer AACTCTGCCTCTGGACGAAA
 
Template 
CATGCCTGCAGGTCGACTCTAGAGGATCCCCCTGCATTAGTCAGGGGTACAAAGGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTGTATAGGCTGGAAAGTTCCACATTT
GCAGGGCTTAGAAAACTCTGCCAGGGGCTGATGTTGCTCTCTTGAATCAAAATTTCGTCCAGAG
GCAGAGTTCCTTCCTGAGTAACCACAGCCCTTTCTCTGAAGCCTTCATCTGACTGTTTGAAACT
TACTCACATTAGGCCAAGTGATCCATCTGCCTTATCCAAGGTCTTCTGATTTAAATTATAATCA
CATCTCAGAAAATAATTTCAGACCAACCACCAGTATCTAGTTTAACCAAACAACTGGATACCCT
GACACACAAAATTAACTGTAACATATCCCTATAGATAACTTGGCAAATAATACCTAATCATTCA
CTCAGCCAATGTAGCCAAGATCCAGAGGGGTACGAGCTCGAATTCGTATCATGGTCA

Region

Nucleotide Sequences
GenBank Nucleotide CH474013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4130372989Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4131934116Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4131934116Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4131934116Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4131934116Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4132584199Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4133250345Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4133250345Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4139505420Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)421079645210796Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
1358201Gluco12Glucose level QTL121.6adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake (CMO:0000870)4521839229593287Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4994088544463908Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)41002490139524530Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)42133334339505420Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)42133334344463908Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
8552803Bw144Body weight QTL 14416body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)42271068534430484Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 554296 UniSTS
  554298 UniSTS
UniSTS 121935 UniSTS