DXRat66 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXRat66

Symbol: DXRat66
Previously known as: R0009-B12; oxsts7617; 
RGD ID: 34991
Expected Size: 138 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X110,639,479 - 110,639,627 (+)MAPPERmRatBN7.2
Rnor_6.0X36,769,460 - 36,769,609NCBIRnor6.0
Rnor_6.0X118,083,215 - 118,083,362NCBIRnor6.0
Rnor_5.0X118,224,438 - 118,224,585UniSTSRnor5.0
RGSC_v3.4X31,245,654 - 31,245,802RGDRGSC3.4
RGSC_v3.4X31,245,655 - 31,245,802UniSTSRGSC3.4
RGSC_v3.1X31,299,123 - 31,299,271RGD
CeleraX109,957,262 - 109,957,405UniSTS
SHRSP x BN MapX31.99RGD
SHRSP x BN MapX31.99UniSTS
Cytogenetic MapXq34-q35.1UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cia19  
Genes:   Htr2c  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic dissection of a rat model for rheumatoid arthritis: significant gender influences on autosomal modifier loci Furuya T, etal., Hum Mol Genet 2000 Sep 22;9(15):2241-50
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CCCCCAGAGAGATAGACCAG
Reverse Primer AGCGGTGGGGAAACACTGT
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474047 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X65612192120568734Rat
724551Glom1Glomerulus QTL 12.80.0004kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)X75294106120294106Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX100567703150256146Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X103312877148312877Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X103312877148312877Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X93956491138956491Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 25187 UniSTS
  326439 UniSTS
UniSTS 119217 UniSTS