D14Rat10 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D14Rat10

Symbol: D14Rat10
Previously known as: R0009-C11; oxsts6190; R009-C11; 
RGD ID: 34965
Expected Size: 176 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21430,883,777 - 30,883,947 (+)MAPPERmRatBN7.2
Rnor_6.01433,163,316 - 33,163,485NCBIRnor6.0
Rnor_5.01432,957,485 - 32,957,654UniSTSRnor5.0
RGSC_v3.41433,157,432 - 33,157,602RGDRGSC3.4
RGSC_v3.41433,157,433 - 33,157,602UniSTSRGSC3.4
RGSC_v3.11433,157,433 - 33,157,602RGD
RH 3.4 Map14396.7UniSTS
RH 3.4 Map14396.7RGD
RH 2.0 Map14358.0RGD
SHRSP x BN Map1420.42RGD
FHH x ACI Map1427.2299RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   F344.OLETF-(D14Rat23-D14Rat10)/Tj  
QTLs:   Srn3   Bp189  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCAGGTTCCATGAGACCCTA
Reverse Primer GCTTGAATTTGCATGGAGCT
 
Template
CTANGGNTCCCCCCCTTTTATTATCATTTGAGATAGTTCATGCATTCCAGGCTGCTTGAATTTG
CATGGAGCTAAAGACATTAAACTTCTGATTCTTCAGGTGCATAGGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTACCTGAGATCAAAGCTGAATTATCTCCCTTGGCTTCTTTCTA
CCTTATTGTTTGAAATAGGGTCTCATGGAACCTGGGGTAAGACGAGATAAAAATACCTGAGGCA
GACGCAGGCTGATTTCCAAGTTCCATGTCAGCCTGGACTACTTAGTGCAGTGGTTCTCCAGCTG
TGGGCTGCGGGGGTACCGAGCTCGAATTCGTAATCATGGTCAATAGCTGTTTCCTGTGTGAAAT
TGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTG
CCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTNCCCGCTTTCCAGTCGGGAAA
CCTGTCGTGCCANCATGCATTAATGAATCGGCCNACGCGCGGGGAGAGGCGGNTTGNGTAT

Region

Nucleotide Sequences


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14908897839057237Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1300140Srn3Serum renin concentration QTL 33.19blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)141487516830883947Rat
71117Niddm17Non-insulin dependent diabetes mellitus QTL 172.35blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)141759376142336881Rat
631262Tcas4Tongue tumor susceptibility QTL 47.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)141762256142337007Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141854133263541332Rat
61420Pia6Pristane induced arthritis QTL 64.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)141863134542337007Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
2324617Coatc2Coat color QTL 20.001coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)143076702539153750Rat
1300154Bp189Blood pressure QTL 1893.04arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)143088377768757901Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 444939 UniSTS
  444953 UniSTS
UniSTS 118351 UniSTS