D14Mit14 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D14Mit14

Symbol: D14Mit14
Previously known as: R1103-A02; oxsts8887; 
RGD ID: 33915
Expected Size: 246 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2717,116,236 - 17,116,475 (+)MAPPERmRatBN7.2
mRatBN7.2716,022,133 - 16,022,370 (+)MAPPERmRatBN7.2
Rnor_6.0721,182,633 - 21,182,864NCBIRnor6.0
Rnor_6.0721,180,182 - 21,180,417NCBIRnor6.0
Rnor_5.0721,343,813 - 21,344,048UniSTSRnor5.0
Rnor_5.0721,346,797 - 21,347,028UniSTSRnor5.0
RGSC_v3.4719,190,401 - 19,190,632UniSTSRGSC3.4
RGSC_v3.4718,638,086 - 18,638,322UniSTSRGSC3.4
RGSC_v3.1719,198,536 - 19,198,882RGD
Cytogenetic Map7q13UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OM/Ztm   P5C   PVG/Pit   SD/Rij   WAG/RijKyo   GK/KyoSwe   M520/N   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Ube2r2l2   LOC691708  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGTTAAGGCCAGGCTGGTT
Reverse Primer CCCAAAACAGAAACAAAGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3799Syn3synapsin III71621605517808790Rat
1566251Ddx21-ps11DExD-box helicase 21, pseudogene 1171617078816192428Rat
1582768Ube2r2l1ubiquitin-conjugating enzyme E2R 2 like 171604854916114151Rat
1595959Ube2r2l2ubiquitin-conjugating enzyme E2R 2 like 271704573717118072Rat
6487955Ddx21-ps3DExD-box helicase 21, pseudogene 371634899216373674Rat
9305037LOC10369063560S ribosomal protein L22 pseudogene71670570616706053Rat
41327657LOC120093786ubiquitin-conjugating enzyme E2 R2-like71602087716023868Rat
41389346LOC120093785ubiquitin-conjugating enzyme E2 R2-like71651044716540626Rat
40958441Ddx21-ps5DExD-box helicase 21, pseudogene 571643436916436631Rat
40938575Smokl7sperm motility kinase like 771643642916454756Rat
41333693Mex3a-ps2mex-3 RNA binding family member A, pseudogene 271614181016143932Rat
41019284Smokl4sperm motility kinase like 471633024316348592Rat
41046145Trnas-aga53transfer RNA serine (anticodon AGA) 5371682375916823831Rat

Nucleotide Sequences
GenBank Nucleotide AU047534 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH615902.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)71557388960573889Rat
1582260Bw72Body weight QTL 723.20.0043body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1582261Bw69Body weight QTL 693.20.0048body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
1582262Bw75Body weight QTL 7530.0038body mass (VT:0001259)body weight (CMO:0000012)71579556538073970Rat
2317059Aia15Adjuvant induced arthritis QTL 152.46joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)71700459862004598Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 691708 UniSTS
  691764 UniSTS
UniSTS 240264 UniSTS