D7Mit5 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D7Mit5

Symbol: D7Mit5
Previously known as: R1101-D04; MIT217; R217; oxsts5237; 
RGD ID: 33648
Expected Size: 141 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2780,221,299 - 80,221,436 (+)MAPPERmRatBN7.2
Rnor_6.0788,365,265 - 88,365,401NCBIRnor6.0
Rnor_5.0788,393,619 - 88,393,755UniSTSRnor5.0
RGSC_v3.4785,089,895 - 85,090,032RGDRGSC3.4
RGSC_v3.4785,089,896 - 85,090,032UniSTSRGSC3.4
RGSC_v3.1785,110,626 - 85,110,762RGD
Celera777,115,894 - 77,116,030UniSTS
RH 3.4 Map7539.2UniSTS
RH 3.4 Map7539.2RGD
RH 2.0 Map7467.1RGD
SHRSP x BN Map747.81RGD
FHH x ACI Map736.72RGD
Cytogenetic Map7 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   SS/Jr   COP/OlaHsd  
QTLs:   Bp38   Niddm52   Tls2   Bp214   Kidm9   Kidm10   Teswt1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genome scan and congenic strains for blood pressure QTL using Dahl salt-sensitive rats. Garrett MR, etal., Genome Res 1998 Jul;8(7):711-23
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
5. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
6. UniSTS Pipeline RGD automated pipelines
7. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
8. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
9. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TACTGTTTCTTTAACACATGCACA
Reverse Primer AGCCATATATGCATGTACACAAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2324771Snw1-ps2SNW domain containing 1, pseudogene 278014008780332987Rat

Nucleotide Sequences
GenBank Nucleotide CH473950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)74486753389867533Rat
738030Anxrr8Anxiety related response QTL 84.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)74659007091590070Rat
2293696Bmd32Bone mineral density QTL 325.10.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)74765143992651439Rat
2293707Bss32Bone structure and strength QTL 327.640.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)74765143992651439Rat
2300178Bmd54Bone mineral density QTL 545.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)74765143992651439Rat
2293644Bmd29Bone mineral density QTL 295.40.0001femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)74765143992651439Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
2293685Bmd21Bone mineral density QTL 214.20.0003femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)74765143992651439Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)753612714103945643Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)761074194106074194Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)762004452101773158Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)762004452101773158Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)768938720113886318Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)768938720113886318Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)768938720113886318Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)769736226117455174Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)769736356112729554Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
724537Niddm52Non-insulin dependent diabetes mellitus QTL 520.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)78022129993595843Rat
1641908Teswt1Testicular weight QTL 13.28testis mass (VT:1000644)both testes wet weight (CMO:0000175)78022129994811326Rat
631529Tls2T-lymphoma susceptibility QTL 200.001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)780221299109401111Rat
1331746Kidm9Kidney mass QTL 93.934kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)780221299112308525Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)780221299125221299Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302909 UniSTS
  326373 UniSTS
  369098 UniSTS
  387452 UniSTS
  544348 UniSTS
  544366 UniSTS
  544388 UniSTS
UniSTS 119007 UniSTS