D10Mit15 Marker Search Result - Rat Genome Database

General

Marker: D10Mit15

Symbol:

D10Mit15

Previously known as:

oxsts8812;

RGD ID:

33600

Expected Size:

185 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	10	4,826,397 - 4,826,582 (+)	MAPPER	mRatBN7.2
Rnor_6.0	10	4,896,694 - 4,896,878	NCBI	Rnor6.0
Rnor_5.0	10	3,723,602 - 3,723,786	UniSTS	Rnor5.0
RGSC_v3.4	10	4,759,264 - 4,759,449	RGD	RGSC3.4
RGSC_v3.4	10	4,759,265 - 4,759,449	UniSTS	RGSC3.4
RGSC_v3.1	10	4,759,264 - 4,759,449	RGD

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BDIX/Han BDVII/Cub BN/SsNHsd BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LH/Mav MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo M520/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CACCAATGCTACAGCAAATG
Reverse Primer	AGGAGTGCACAGTGCTCATG

Strain Variation

Strain, Expected Size(s)

AVN/Orl	180
BBDP/Rhw	176
BDIX/Han	186
BDVII/Cub	180
BN-Lx/Cub	186
BN/SsNHsd	186
BUF/Pit	186
COP/OlaHsd	178
DA/PitN	186
DON/Melb	186
F344/Pit	186

FHH/Eur	186
GH/Omr	180
IS/Kyo	210
LE/Mol	180
LH/Mav	186
LN/Mav	186
LOU/CHan	176
M520/N	186
MNR/N	186
MNRA/N	186
MNS/Gib	178

MR/Pit	186
NEDH/K	186
NP9	186
ODU/N	186
OKA/Wsl	186
P5C	182
PVG/Pit	180
SD/Rij	180
SHR/OlaHsd	186
SHRSP/Riv	186
SR/Jr	186

SS/Jr	186
WAG/RijKyo	180
WF/Pit	186
WIST/Nhg	186
WKY/OlaHsd	180
WN/N	170
WTC/Kyo	178

Region

Nucleotide Sequences

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
634329	Pia15	Pristane induced arthritis QTL 15	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	1	24158324	Rat
2293680	Bss40	Bone structure and strength QTL 40	5.66	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	10	1	35225947	Rat
634327	Hc4	Hypercalciuria QTL 4	2.4		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	10	1	38328221	Rat
7411611	Foco17	Food consumption QTL 17	18.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	1	42315980	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat
10401803	Kidm50	Kidney mass QTL 50			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	10	418344	45418344	Rat
631554	Bp133	Blood pressure QTL 133		0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	743364	63851208	Rat
1549898	Neuinf3	Neuroinflammation QTL 3	26.4		nervous system integrity trait (VT:0010566)	MHC Class II RT1A-positive spinal cord ventral horn area to total spinal cord ventral horn area ratio (CMO:0001980)	10	3406320	5387112	Rat
1576304	Schws7	Schwannoma susceptibility QTL 7		0.0115	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	4765527	19816042	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
UniSTS	120626	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D10Mit15