D13Mit13 Marker Search Result - Rat Genome Database

General

Marker: D13Mit13

Symbol:

D13Mit13

Previously known as:

R37; oxsts8866;

RGD ID:

33573

Expected Size:

106 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	17	8,112,457 - 8,112,650 (+)	MAPPER	mRatBN7.2
Rnor_6.0	17	8,559,513 - 8,559,705	NCBI	Rnor6.0
Rnor_5.0	17	10,733,867 - 10,734,059	UniSTS	Rnor5.0
RGSC_v3.4	17	14,069,443 - 14,069,635	UniSTS	RGSC3.4
RGSC_v3.1	13	106,281,961 - 106,282,066	RGD
Celera	17	8,204,921 - 8,205,113	UniSTS
RH 3.4 Map	13	703.0	RGD
RH 2.0 Map	13	744.0	RGD
Cytogenetic Map	17	p14	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
Genes: Il9

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	UniSTS Pipeline	RGD automated pipelines
4.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	CTGTGGTAAGTCCAGATTTG
Reverse Primer	GGAAAGAGTAGGAAGATGCC

Strain Variation

Strain, Expected Size(s)

ACI/N	101
AVN/Orl	111
BBDP/Rhw	106
BBDR/Rhw	106
BC/CpbU	111
BDIX/Han	106
BDVII/Cub	106
BN-Lx/Cub	106
BN/SsNHsd	106
BP/Cub	106
BUF/Pit	106
COP/OlaHsd	101
DA/PitN	106

DON/Melb	106
F344/Pit	106
FHH/Eur	108
GH/Omr	106
GK/KyoSwe	106
IS/Kyo	108
LE/Mol	108
LEW/Pit	106
LH/Mav	106
LN/Mav	106
LOU/CHan	106
M520/N	106
MHS/Gib	106

MNR/N	101
MNRA/N	101
MNS/Gib	101
MR/Pit	101
NEDH/K	106
NP9	106
ODU/N	111
OKA/Wsl	108
OM/Ztm	101
P5C	106
PVG/Pit	106
SD/Rij	106
SHR/OlaHsd	106

SHRSP/Riv	106
SR/Jr	106
SS/Jr	106
WAG/RijKyo	106
WF/Pit	101
WIST/Nhg	101
WKY/OlaHsd	108
WN/N	106
WTC/Kyo	111

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
620049	Il9	interleukin 9	17	8111772	8114895	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473985	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH474032	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000243	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000247	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH617941.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
9590316	Scort21	Serum corticosterone level QTL 21	4.75	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	17	1	22871563	Rat
10401807	Kidm52	Kidney mass QTL 52			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	17	1	31701463	Rat
70184	BpQTLcluster14	Blood pressure QTL cluster 14	3.38		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	17	1	31990913	Rat
631207	Niddm41	Non-insulin dependent diabetes mellitus QTL 41			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	17	1	37830672	Rat
1354658	Spl8	Serum phospholipid level QTL 8	3.8		blood VLDL phospholipid amount (VT:0010507)	blood very low density lipoprotein phospholipid level (CMO:0001571)	17	1	60781592	Rat
1354581	Bp247	Blood pressure QTL 247	4.5		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	17	1	69599340	Rat
1354662	Rf49	Renal function QTL 49	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	17	1	69599340	Rat
1641902	Colcr7	Colorectal carcinoma resistance QTL 7	3.35	0.0044	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	17	2115149	21881669	Rat
1300123	Bp194	Blood pressure QTL 194	2.82		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	17	2115149	34551001	Rat
631499	Stl1	Serum triglyceride level QTL 1	3.6		blood triglyceride amount (VT:0002644)	blood triglyceride level (CMO:0000118)	17	3271398	27389946	Rat
2324619	Coatc4	Coat color QTL 4		0.001	coat/hair pigmentation trait (VT:0010463)	pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)	17	4299130	21293263	Rat
2324619	Coatc4	Coat color QTL 4		0.001	coat/hair pigmentation trait (VT:0010463)	pigmented dorsal coat/hair area to total dorsal coat/hair area ratio (CMO:0001811)	17	4299130	21293263	Rat
1354613	Kidm14	Kidney mass QTL 14	6.2		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	17	4299130	35837242	Rat
1354596	Bw32	Body weight QTL 32	4.5		body mass (VT:0001259)	body weight (CMO:0000012)	17	4299130	60781592	Rat
1354630	Cm34	Cardiac mass QTL 34	8.7		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	17	4299130	69599340	Rat
1354638	Insul1	Insulin level QTL 1	4.8		blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	17	4299130	69599340	Rat
1354651	Lmblg2	Limb length QTL 2	6		tibia length (VT:0004357)	tibia length (CMO:0000450)	17	4299130	69599340	Rat
2293648	Bmd31	Bone mineral density QTL 31	4.5	0.0001	femur size trait (VT:1000369)	femoral neck cortical cross-sectional area (CMO:0001702)	17	4354487	27028127	Rat
2293664	Bmd28	Bone mineral density QTL 28	5.1	0.0001	femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	17	4354487	27028127	Rat
2303627	Vencon8	Ventilatory control QTL 8		0.001	respiration trait (VT:0001943)	tidal volume (CMO:0000222)	17	4528038	49528038	Rat
10054088	Scort28	Serum corticosterone level QTL 28	2.04	0.0102	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	17	4528038	49528038	Rat
1581553	Pur14	Proteinuria QTL 14	5.3	0.0001	urine total protein amount (VT:0000032)	urine protein excretion rate (CMO:0000759)	17	7979968	16317111	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	116558	UniSTS
UniSTS	116546	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D13Mit13