D16Nkg10 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D16Nkg10

Symbol: D16Nkg10
Previously known as: Ch16E74.8; UniSTS:527793; 
RGD ID: 2315316
Expected Size: 279 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21643,618,229 - 43,618,508 (+)MAPPERmRatBN7.2
Rnor_6.01646,566,359 - 46,566,637NCBIRnor6.0
Rnor_5.01646,298,488 - 46,298,766UniSTSRnor5.0
RGSC_v3.41646,778,459 - 46,778,737UniSTSRGSC3.4
Celera1641,642,529 - 41,642,807UniSTS
Cytogenetic Map16q11UniSTS
Is Marker For: Genes:   Tenm3  


Annotation


References - curated
# Reference Title Reference Citation
1. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGCAGTGGGAAAACAGTC
Reverse Primer ATATGCATTTCCACCCTTGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306641Tenm3teneurin transmembrane protein 3164125190943978594Rat

Nucleotide Sequences


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
1578768Stresp22Stress response QTL 222.8thymus mass (VT:0004954)thymus wet weight (CMO:0000855)163528887080288870Rat
2293690Bss45Bone structure and strength QTL 455.130.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)163775215682752156Rat
2300163Bmd64Bone mineral density QTL 645.30.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)163775215682752156Rat
7205510Activ5Activity QTL 53.780.00028locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)164239634584729064Rat
631833Sach2Saccharin preference QTL 240.01consumption behavior trait (VT:0002069)calculated saccharin drink intake rate (CMO:0001613)164302484250166018Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306451 UniSTS
UniSTS 527793 UniSTS