D1Mco111 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D1Mco111

Symbol: D1Mco111
Previously known as: D1MUO10; UniSTS:527727; 
RGD ID: 2315172
Expected Size: 190 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0135,190,165 - 35,190,354NCBIRnor6.0
Rnor_5.0136,589,937 - 36,590,126UniSTSRnor5.0
RGSC_v3.4172,680,797 - 2,680,986UniSTSRGSC3.4
Celera131,168,608 - 31,168,797UniSTS
Cytogenetic Map17p14UniSTS
Is Marker For: Genes:   Adamts16  


Annotation


References - curated
# Reference Title Reference Citation
1. Positional identification of variants of Adamts16 linked to inherited hypertension. Joe B, etal., Hum Mol Genet. 2009 Aug 1;18(15):2825-38. Epub 2009 May 7.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGAAATCTTGCCACACGAG
Reverse Primer GAGGGGGTGTGAGGAAGG
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
sslps_general These markers, as genotyped on S.LEW RNO1 congenic strains, are located between D1Rat211 and D1Rat12. The current rat genome assembly places the genomic fragment from D1Rat211-D1Rat12 on RNO17. Celera assembly of the rat genome confirms our mapping of the location of the fragment from D1Rat211-D1Rat12 as being on Chromosome 1 and not on Chromosome 17 2312639
Database Acc Id Source(s)
NCBI Gene 306664 UniSTS
UniSTS 527727 UniSTS