D20Yum4 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D20Yum4

Symbol: D20Yum4
Previously known as: UniSTS:526146; 
RGD ID: 2303283
Expected Size: 206 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2201,696,732 - 1,696,938 (+)MAPPERmRatBN7.2
Rnor_6.0202,190,121 - 2,190,326NCBIRnor6.0
Rnor_5.0204,226,877 - 4,227,082UniSTSRnor5.0
RGSC_v3.4201,789,402 - 1,789,607UniSTSRGSC3.4
Celera202,405,478 - 2,405,683UniSTS
Cytogenetic Map20p12UniSTS
Is Marker For: Genes:   Trim10  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines
2. An informative set of SSLP markers and genomic profiles in the rat MHC, the RT1 complex. Takagi Y, etal., Immunogenetics. 2008 Dec 24.

Strains and Sequence

Sequence
 
Forward Primer ACCCATTAACCATTGCAGGT
Reverse Primer TCAACCCCTAACCCTGTGAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359438Trim10tripartite motif-containing 102016895541698948Rat

Nucleotide Sequences
GenBank Nucleotide BX883051 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH619561.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724519Bp144Blood pressure QTL 1440.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2013624629Rat
1354642Despr15Despair related QTL 150.0027locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)20124159021Rat
1600382Edcs3Endometrial carcinoma susceptibility QTL33.50.003uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)20125159026Rat
2317851Alcrsp22Alcohol response QTL 223.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
1641893Alcrsp7Alcohol response QTL 7response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
8694189Bw153Body weight QTL 1533.130.001body mass (VT:0001259)body weight gain (CMO:0000420)20129191651Rat
9590275Scort15Serum corticosterone level QTL 153.480.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20129191651Rat
7411650Foco23Food consumption QTL 2320.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20129191651Rat
9590109Sffal8Serum free fatty acids level QTL 85.320.01blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)20129191651Rat
9589155Insul32Insulin level QTL 326.380.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20129191651Rat
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
2306850Pia40Pristane induced arthritis QTL 400.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)2015279595304575Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 294210 UniSTS
UniSTS 526146 UniSTS