D17Wox27 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D17Wox27

Symbol: D17Wox27
Previously known as: oxsts5667; REP499; 
RGD ID: 1640650
Expected Size: 181 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21784,761,443 - 84,761,624 (+)MAPPERmRatBN7.2
Rnor_6.01789,169,390 - 89,169,570NCBIRnor6.0
Rnor_5.01790,849,513 - 90,849,693UniSTSRnor5.0
RGSC_v3.41796,257,244 - 96,257,424UniSTSRGSC3.4
Celera1784,129,565 - 84,129,745UniSTS
Cytogenetic Map17 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CATCCATTTCTTCCTTGTGAG
Reverse Primer GAGCCTGGGTCTTTGTTTAA
 

Region

Nucleotide Sequences
GenBank Nucleotide AF090195 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)176078142686533673Rat
7411577Bw141Body weight QTL 1410.001body mass (VT:0001259)body weight gain (CMO:0000420)176261951686533673Rat


Additional Information

Database Acc Id Source(s)
UniSTS 518984 UniSTS