DXGot190 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXGot190

Symbol: DXGot190
Previously known as: oxsts3487; OT28.11; D0Got456; 
RGD ID: 1638722
Expected Size: 158 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X141,937,659 - 141,937,817 (+)MAPPERmRatBN7.2
Rnor_6.0X146,684,328 - 146,684,485NCBIRnor6.0
Rnor_5.0X146,695,738 - 146,695,895UniSTSRnor5.0
RGSC_v3.4X149,300,423 - 149,300,580UniSTSRGSC3.4
CeleraX137,907,305 - 137,907,480UniSTS
Cytogenetic MapX RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGCTTTACAAGCTCTGCTGAG
Reverse Primer AAACACGTTTTTGGGTATTCCAC
 

Region

Nucleotide Sequences
GenBank Nucleotide AU026595 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX100567703150256146Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X103312877148312877Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X103312877148312877Rat
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X113937816152453651Rat
634346Insul4Insulin level QTL 40blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)X126975089152453651Rat


Additional Information

Database Acc Id Source(s)
UniSTS 114127 UniSTS