D11Got134 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D11Got134

Symbol: D11Got134
Previously known as: oxsts3939; OT57.19; D0Got739; 
RGD ID: 1633415
Expected Size: 151 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21152,762,860 - 52,763,011 (+)MAPPERmRatBN7.2
Rnor_6.01155,418,532 - 55,418,682NCBIRnor6.0
Rnor_5.01158,583,728 - 58,583,878UniSTSRnor5.0
RGSC_v3.41154,059,914 - 54,060,064UniSTSRGSC3.4
Celera1152,355,121 - 52,355,271UniSTS
Cytogenetic Map11 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCGGCAAGTGCAAAGTCC
Reverse Primer CGATCCAAATCACAGTCTGAGTTA
 

Region

Nucleotide Sequences
GenBank Nucleotide AU028199 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH744784 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)112295940367959403Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
9590313Scort20Serum corticosterone level QTL 206.510.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)112328045668280456Rat
9589032Epfw10Epididymal fat weight QTL 109.290.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)112328045668280456Rat
8694424Bw162Body weight QTL 1623.80.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)112952841860324829Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat
2298551Neuinf10Neuroinflammation QTL 103.7nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)113123913478851519Rat
70180BpQTLcluster10Blood pressure QTL cluster 103.19arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)113491804179918041Rat
1300135Rf19Renal function QTL 193.38blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)114094618882566702Rat
2312566Glom20Glomerulus QTL 203.60.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)114428575982566702Rat
1581565Pur10Proteinuria QTL 100.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
1581572Uae35Urinary albumin excretion QTL 350.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
4889859Pur28Proteinuria QTL 2819.50.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)114545932375190161Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112560 UniSTS