D17Got231 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D17Got231

Symbol: D17Got231
Previously known as: oxsts2952; OT05.04; D0Got93; 
RGD ID: 1631996
Expected Size: 288 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.217864,552 - 864,835 (-)MAPPERmRatBN7.2
Rnor_6.0171,777,624 - 1,777,906NCBIRnor6.0
Rnor_5.0171,767,180 - 1,767,462UniSTSRnor5.0
RGSC_v3.4176,390,915 - 6,391,197UniSTSRGSC3.4
Celera171,651,890 - 1,652,172UniSTS
Cytogenetic Map17p14UniSTS
Is Marker For: Genes:   Cdc14b  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTCTCCTCATAGCACACACCA
Reverse Primer GCTTCCACATTCATCAGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1311163Cdc14bcell division cycle 14B17844686934787Rat

Nucleotide Sequences
GenBank Nucleotide AC125727 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU028699 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590316Scort21Serum corticosterone level QTL 214.750.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17122871563Rat
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 361195 UniSTS
UniSTS 112073 UniSTS