D19Got121 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19Got121

Symbol: D19Got121
Previously known as: oxsts3507; OT29.28; D0Got468; 
RGD ID: 1630560
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21956,483,791 - 56,484,006 (+)MAPPERmRatBN7.2
Rnor_6.01961,455,318 - 61,455,532NCBIRnor6.0
Rnor_5.01972,107,244 - 72,107,458UniSTSRnor5.0
RGSC_v3.41958,458,412 - 58,458,626UniSTSRGSC3.4
Celera1955,817,358 - 55,817,572UniSTS
Cytogenetic Map19q12UniSTS
Is Marker For: Genes:   Nrp1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATCAAAGGCAGTCAACAGCAG
Reverse Primer GTGTACCCCAATAGACACTGTTCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621588Nrp1neuropilin 1195635945556514628Rat

Nucleotide Sequences
GenBank Nucleotide AU026566 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 246331 UniSTS
UniSTS 114156 UniSTS