D1Mit30 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mit30

Symbol: D1Mit30
Previously known as: oxsts9007; 
RGD ID: 11439
Expected Size: 182 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2194,494,440 - 94,494,763 (+)MAPPERmRatBN7.2
mRatBN7.2194,494,579 - 94,494,763 (+)MAPPERmRatBN7.2
Rnor_6.0199,983,524 - 99,983,705NCBIRnor6.0
Rnor_6.0199,983,293 - 99,983,705NCBIRnor6.0
Rnor_5.01101,048,742 - 101,049,154UniSTSRnor5.0
Rnor_5.01101,048,973 - 101,049,154UniSTSRnor5.0
RGSC_v3.4194,473,941 - 94,474,122UniSTSRGSC3.4
RGSC_v3.4194,473,940 - 94,474,122RGDRGSC3.4
RGSC_v3.1194,552,051 - 94,552,233RGD
Celera188,761,687 - 88,761,868UniSTS
RH 3.4 Map1904.9UniSTS
RH 3.4 Map1904.9RGD
RH 2.0 Map1595.2RGD
Cytogenetic Map1q22UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   SHRSP.SHR-(D1Mit30-D1Rat269)/Izm  
QTLs:   Niddm23   Hrtrt11   Bp199   Bp200   Scl25  
Genes:   Klk1c2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGTCTTGGCCTCTGATTTCA
Reverse Primer TGCTGTGTGGACGGAGATAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3888Klk1c2kallikrein 1-related peptidase C219449233294496480Rat

Nucleotide Sequences
GenBank Nucleotide M26533 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)192948896144267916Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331800Scl25Serum cholesterol level QTL 253.013blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)194494440117601394Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)183547917128547917Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)190664883143200202Rat
1302788Scl19Serum cholesterol QTL 194.60.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)190532338123479925Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)185424647100358001Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)182174743118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
2293142Bp314Blood pressure QTL 314arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192184926137184926Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)180592172125592172Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24841 UniSTS
  326535 UniSTS
  544369 UniSTS
  544371 UniSTS
  544455 UniSTS
  544462 UniSTS
UniSTS 120261 UniSTS