D8Mgh3 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D8Mgh3

Symbol: D8Mgh3
Previously known as: R1102-A01; oxsts9211; 
RGD ID: 11222
Expected Size: 140 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2899,103,367 - 99,103,503 (+)MAPPERmRatBN7.2
Rnor_6.08106,526,605 - 106,526,740NCBIRnor6.0
Rnor_5.08105,968,444 - 105,968,579UniSTSRnor5.0
RGSC_v3.48103,684,650 - 103,684,785UniSTSRGSC3.4
RGSC_v3.48103,684,649 - 103,684,785RGDRGSC3.4
RGSC_v3.18103,704,104 - 103,704,240RGD
Celera898,512,833 - 98,512,971UniSTS
RH 3.4 Map81051.79RGD
RH 3.4 Map81051.79UniSTS
RH 2.0 Map8841.5RGD
SHRSP x BN Map859.54RGD
FHH x ACI Map869.0899RGD
Cytogenetic Map8q31UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Hcar3   Kidm26   Bp262   Cm40  
Genes:   Rbp2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer AGCCGGCTACTCATTTGCTA
Reverse Primer AGAGCTGGGTACTTGCCTGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3544Rbp2retinol binding protein 289907929399104489Rat

Nucleotide Sequences
GenBank Nucleotide JH616520.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M16402 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)82720571599103503Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)82720571599103503Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)82720571599103503Rat
8662823Vetf5Vascular elastic tissue fragility QTL 51.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)82824291299525068Rat
1578755Pur5Proteinuria QTL 53.30.0001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)830848154101699754Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)830848154101699754Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)830848259105647037Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)846531639119088626Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)846531639119088626Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)846531639119088626Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)846531639119088626Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)851351728107062046Rat
631664Hcar3Hepatocarcinoma resistance QTL 32.90.0005liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)85423764499103503Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)854259986100382532Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)861290298119084929Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)866142385111142385Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight to body weight ratio (CMO:0000654)869349194112783834Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)870513503118219066Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)871888757116888757Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)871888757116888757Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)871888757116888757Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)871888757116888757Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)873473045118473045Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)876468691121468691Rat
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)882460758122812818Rat
2313400Anxrr25Anxiety related response QTL 25aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)889265192114019816Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)893535351123900184Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)895718998123900184Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)895718998123900184Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302762 UniSTS
  100302764 UniSTS
  100303155 UniSTS
  24710 UniSTS
  369162 UniSTS
UniSTS 119609 UniSTS