D4Mgh31 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Mgh31

Symbol: D4Mgh31
Previously known as: PPTA3; oxsts9103; 
RGD ID: 11136
Expected Size: 310 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0433,641,609 - 33,641,941NCBIRnor6.0
Rnor_5.0433,502,647 - 33,502,979UniSTSRnor5.0
RGSC_v3.4432,652,422 - 32,652,754UniSTSRGSC3.4
Celera431,186,569 - 31,186,901UniSTS
Cytogenetic Map4q21UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Tac1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer GCCCAATGGTTTTGATTGAG
Reverse Primer TTAATCCCCTTCCTGCCATT
 

Region

Nucleotide Sequences
GenBank Nucleotide M34161 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24806 UniSTS
NCBI Nucleotide M34162
UniSTS 517843 UniSTS