Marker: DXWox5 |
Symbol: |
DXWox5 |
Previously known as: |
oxsts5780; R160;
|
RGD ID: |
10944 |
Expected Size: |
111 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | X | 17,041,245 - 17,041,356 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | X | 17,826,537 - 17,826,647 | NCBI | Rnor6.0 | Rnor_5.0 | X | 18,608,522 - 18,608,632 | UniSTS | Rnor5.0 | RGSC_v3.4 | X | 28,060,209 - 28,060,319 | UniSTS | RGSC3.4 | RGSC_v3.4 | X | 28,059,408 - 28,067,436 | RGD | RGSC3.4 | RGSC_v3.1 | X | 28,113,677 - 28,113,788 | RGD | | Celera | X | 17,111,264 - 17,111,374 | UniSTS | | RH 3.4 Map | X | 177.2 | UniSTS | | RH 3.4 Map | X | 177.2 | RGD | | RH 2.0 Map | 21 | 136.2 | RGD | | Cytogenetic Map | X | q13-q14 | UniSTS | | Cytogenetic Map | X | q13 | UniSTS | |
|
Is Marker For: |
Genes:
Mycs
LOC680067
|
Annotation
References - curated
# |
Reference Title |
Reference Citation |
1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
3. |
UniSTS Pipeline |
RGD automated pipelines
|
4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
TGGGAAGTTTGGTTCTTTTG |
Reverse Primer |
CTATGCAGTTTTCTCAGAAGCTAA |
|
Region
QTLs in Region (mRatBN7.2)
731181 | Uae27 | Urinary albumin excretion QTL 27 | 2.7 | 0.0059 | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | X | 1 | 43491017 | Rat | 634325 | Bw13 | Body weight QTL 13 | 0 | | body mass (VT:0001259) | body weight (CMO:0000012) | X | 1447972 | 20991088 | Rat | 70165 | Bp64 | Blood pressure QTL 64 | 5.2 | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | X | 1448129 | 31706553 | Rat | 631204 | Gluco15 | Glucose level QTL 15 | | 0.001 | blood glucose amount (VT:0000188) | blood glucose level area under curve (AUC) (CMO:0000350) | X | 1623715 | 22646544 | Rat | 1298071 | Edpm12 | Estrogen-dependent pituitary mass QTL 12 | 3.2 | | pituitary gland mass (VT:0010496) | pituitary gland wet weight (CMO:0000853) | X | 2927898 | 47927898 | Rat | 10755455 | Coatc13 | Coat color QTL 13 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 4406000 | 49406000 | Rat | 631666 | Iddm5 | Insulin dependent diabetes mellitus QTL 5 | | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 4494549 | 49494549 | Rat | 61430 | Cia18 | Collagen induced arthritis QTL 18 | 3.1 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | X | 14843113 | 120568734 | Rat | 71116 | Niddm16 | Non-insulin dependent diabetes mellitus QTL 16 | 7.81 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 15297802 | 60297802 | Rat | |
Additional Information
|
|