D1Mgh12 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mgh12

Symbol: D1Mgh12
Previously known as: S65119; R1100-B03; CASPAT; oxsts4756; 
RGD ID: 10674
Expected Size: 102 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01270,716,905 - 270,717,037NCBIRnor5.0
RGSC_v3.41247,322,146 - 247,322,277RGDRGSC3.4
RGSC_v3.11247,436,621 - 247,436,752RGD
Celera1238,204,080 - 238,204,181UniSTS
RH 3.4 Map11616.91UniSTS
RH 3.4 Map11616.91RGD
RH 2.0 Map11221.1RGD
SHRSP x BN Map1133.51RGD
Cytogenetic Map1q54UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   DRH.F344-(D1Mgh8-D1Mgh12)/Shigm  
QTLs:   Eae7   Rf1   Bp42   Niddm24   Bw20   Iddm9   Hcar6   Bw39   Bw45   Bw42   Hcar15   Bp259   Kidm22   Rf52   Edcs4   Bw83   Insul11  
Genes:   Got1   Rf1  


Annotation


References - curated
# Reference Title Reference Citation
1. Evidence for common autoimmune disease genes controlling onset, severity, and chronicity based on experimental models for multiple sclerosis and rheumatoid arthritis. Bergsteinsdottir K, etal., J Immunol 2000 Feb 1;164(3):1564-8
2. A linkage map of the rat genome derived from three F2 crosses. Bihoreau MT, etal., Genome Res 1997 May;7(5):434-40.
3. Renal disease susceptibility and hypertension are under independent genetic control in the fawn-hooded rat. Brown DM, etal., Nat Genet 1996 Jan;12(1):44-51
4. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
5. A genetic linkage map of the laboratory rat, Rattus norvegicus. Jacob HJ, etal., Nat Genet 1995 Jan;9(1):63-9
6. Novel quantitative trait loci for blood pressure and related traits on rat chromosomes 1, 10, and 18. Kovacs P, etal., Biochem Biophys Res Commun 1997 Jun 18;235(2):343-8
7. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
8. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
9. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
10. UniSTS Pipeline RGD automated pipelines
11. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
12. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
13. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer GCTTGCTGTACAAACCTCAGG
Reverse Primer CAGCACGGAAGATACAAGCA
 

Region



Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302761 UniSTS
  100302772 UniSTS
  100302839 UniSTS
  100302992 UniSTS
  100303164 UniSTS
  100303244 UniSTS
  100303403 UniSTS
  24401 UniSTS
  246064 UniSTS
  326350 UniSTS
  326364 UniSTS
  326489 UniSTS
  326537 UniSTS
  369167 UniSTS
  387417 UniSTS
  544604 UniSTS
  544644 UniSTS
  544649 UniSTS
NCBI Nucleotide S65119
UniSTS 121448 UniSTS