D10Wox8 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Wox8

Symbol: D10Wox8
Previously known as: oxsts5360; ADRA1B; 
RGD ID: 10095
Expected Size: 263 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RH 3.4 Map10298.61UniSTS
RH 3.4 Map10298.61RGD
RH 2.0 Map10367.3RGD
Cytogenetic Map10q21UniSTS
Is Marker For: Genes:   Adra1b  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TCAGATTCTGCTTGTTTGGTA
Reverse Primer GATATCTTAGTTCCCCCTTGC
 

Region

Nucleotide Sequences
GenBank Nucleotide L08609 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L28752 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 24173 UniSTS
UniSTS 118098 UniSTS