Rpl38-ps9 (ribosomal protein L38, pseudogene 9)

Gene: Rpl38-ps9 (ribosomal protein L38, pseudogene 9) Rattus norvegicus

Analyze

No known orthologs.

Symbol:

Rpl38-ps9

Name:

ribosomal protein L38, pseudogene 9

RGD ID:

1587812

Description:

Orthologous to human RPL38 (ribosomal protein L38).

Type:

pseudo (Ensembl: protein-coding)

RefSeq Status:

INFERRED

Previously known as:

60S ribosomal protein L38; LOC685963; similar to 60S ribosomal protein L38

RGD Orthologs

Alliance Genes

More Info

homologs ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Other homologs ²				less info ...
Homo sapiens (human):	RPL38 (ribosomal protein L38)	HGNC	Treefam
Alliance orthologs ³
Homo sapiens (human):	RPL38 (ribosomal protein L38)	Alliance	DIOPT (Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Mus musculus (house mouse):	Rpl38 (ribosomal protein L38)	Alliance	DIOPT (Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|SonicParanoid)
Danio rerio (zebrafish):	rpl38 (ribosomal protein L38)	Alliance	DIOPT (Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|SonicParanoid)
Caenorhabditis elegans (roundworm):	rpl-38	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):	RPL38	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Drosophila melanogaster (fruit fly):	RpL38	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):	rpl38	Alliance	DIOPT (Ensembl Compara\|OMA\|OrthoFinder)

Related Functional Gene:

Rpl38

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	3	176,399,686 - 176,400,039 (+)	NCBI		GRCr8
mRatBN7.2	3	155,980,667 - 155,981,020 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	3	155,980,625 - 155,981,036 (+)	Ensembl		mRatBN7.2 Ensembl
mRatBN7.2 Ensembl	2	184,905,204 - 184,905,416 (-)	Ensembl		mRatBN7.2 Ensembl
mRatBN7.2 Ensembl	14	94,400,027 - 94,400,239 (+)	Ensembl		mRatBN7.2 Ensembl
mRatBN7.2 Ensembl	16	10,182,742 - 10,182,954 (-)	Ensembl		mRatBN7.2 Ensembl
Rnor_6.0	3	164,002,409 - 164,002,748 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	3	164,002,482 - 164,002,694 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	3	170,159,895 - 170,160,236 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	3	158,404,683 - 158,405,010 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Cytogenetic Map	3	q42	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

References

References - curated

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Genomics

Variants

Variants in Rpl38-ps9
8 total Variants

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
70216	Cm14	Cardiac mass QTL 14	2.1		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	3	31172320	163586636	Rat
1559282	Emca5	Estrogen-induced mammary cancer QTL 5	3.9		mammary gland integrity trait (VT:0010552)	percentage of study population developing mammary tumors during a period of time (CMO:0000948)	3	43827364	169034231	Rat
1581568	Rf53	Renal function QTL 53			urine total protein amount (VT:0000032)	urine protein excretion rate to body weight ratio (CMO:0001099)	3	56395968	161299569	Rat
8662816	Vetf4	Vascular elastic tissue fragility QTL 4	4		renal artery integrity trait (VT:0010642)	number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)	3	59242096	157323038	Rat
631841	Niddm39	Non-insulin dependent diabetes mellitus QTL 39	3.36		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	3	94856903	159898684	Rat
2312659	Slep7	Serum leptin concentration QTL 7		0.001	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	3	98535255	168026850	Rat
2312670	Bw94	Body weight QTL 94		0.01	inguinal fat pad mass (VT:0010424)	inguinal fat pad weight to body weight ratio (CMO:0001253)	3	98535255	168026850	Rat
2312673	Scl63	Serum cholesterol level QTL 63		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	3	98535255	168026850	Rat
2302373	Gluco39	Glucose level QTL 39	5.01		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	3	98535386	161695835	Rat
1578754	Stresp16	Stress response QTL 16	4	0.001	blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	3	112681431	157681431	Rat
1576306	Schws3	Schwannoma susceptibility QTL 3		0.001	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	3	118839124	163839124	Rat
1598877	Bp285	Blood pressure QTL 285	1.5	0.03	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	120538241	165538241	Rat
1300159	Kidm4	Kidney mass QTL 4	3.83		kidney mass (VT:0002707)	right kidney wet weight to body weight ratio (CMO:0001953)	3	121056165	157309487	Rat
10755461	Coatc16	Coat color QTL 16			coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	3	122438700	167438700	Rat
631541	Bp81	Blood pressure QTL 81	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	124122556	169034231	Rat
2303620	Vencon4	Ventilatory control QTL 4	3.9		respiration trait (VT:0001943)	tidal volume (CMO:0000222)	3	127162703	168026850	Rat
631673	Iddm13	Insulin dependent diabetes mellitus QTL 13	1.3	0.663	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	3	130193298	161695983	Rat
1578656	Vnigr2	Vascular neointimal growth QTL 2	4.2		artery morphology trait (VT:0002191)	lesioned artery residual lumen area (CMO:0001417)	3	130656562	169034231	Rat
1578653	Vnigr3	Vascular neointimal growth QTL 3	3.1		artery morphology trait (VT:0002191)	artery neointimal hyperplastic lesion area (CMO:0001414)	3	130656562	169034231	Rat
9589106	Insul23	Insulin level QTL 23	13.86	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	3	131635904	169034231	Rat
2298477	Eau4	Experimental allergic uveoretinitis QTL 4		0.0011	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	3	137398739	169034231	Rat
8552952	Pigfal13	Plasma insulin-like growth factor 1 level QTL 13			blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	3	138799500	169034231	Rat
1298068	Bp167	Blood pressure QTL 167		0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	141074471	169034231	Rat
1331726	Bp208	Blood pressure QTL 208	3.129		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	141339013	162184794	Rat
2317883	Alcrsp26	Alcohol response QTL 26	1.8	0.63	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	3	145526770	169034231	Rat
12879871	Am7	Aortic mass QTL 7		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	3	145925360	166177555	Rat
12879872	Cm97	Cardiac mass QTL 97		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	3	145925360	166177555	Rat
12879873	Cm96	Cardiac mass QTL 96		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	3	145925360	166177555	Rat
12879874	Cm98	Cardiac mass QTL 98		0.005	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	3	145925360	166177555	Rat
12879875	Kidm64	Kidney mass QTL 64		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	3	145925360	166177555	Rat
12879876	Bw182	Body weight QTL 182		0.003	body mass (VT:0001259)	body weight (CMO:0000012)	3	145925360	166177555	Rat
2301411	Bp320	Blood pressure QTL 320		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	145925360	166177555	Rat
1300113	Bp176	Blood pressure QTL 176	3.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	145956084	157309487	Rat
1598854	Memor10	Memory QTL 10	2		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	3	145956084	161299569	Rat
8552791	Vie2	Viral induced encephalitis QTL 2	4.1		brain integrity trait (VT:0010579)	encephalitis incidence/prevalence measurement (CMO:0002361)	3	145956084	169034231	Rat
1578666	Vnigr1	Vascular neointimal growth QTL 1	4.6		artery morphology trait (VT:0002191)	artery lumen area (CMO:0001409)	3	149040888	168026850	Rat

Markers in Region

D3Rat102

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	3	155,979,184 - 155,979,410 (+)	MAPPER	mRatBN7.2
Rnor_6.0	3	164,000,936 - 164,001,161	NCBI	Rnor6.0
Rnor_5.0	3	170,158,689 - 170,158,914	UniSTS	Rnor5.0
RGSC_v3.4	3	158,402,790 - 158,403,016	RGD	RGSC3.4
RGSC_v3.4	3	158,402,791 - 158,403,016	UniSTS	RGSC3.4
RGSC_v3.1	3	158,308,827 - 158,309,052	RGD
RH 3.4 Map	3	1473.6	RGD
RH 3.4 Map	3	1473.6	UniSTS
RH 2.0 Map	3	997.0	RGD
SHRSP x BN Map	3	77.7599	RGD
Cytogenetic Map	3	q42	UniSTS

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High	3				3							2
Medium		43	57	41	16	41	8	11	74	35	41	9	8
Low	3	7	9	7	4	7		3	31	5	26	6
Below cutoff	3	29	23	20	4	20		2	33	24	26	2

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NG_081628	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_001065954	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JAXUCZ010000003	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSRNOT00000023369 ⟹ ENSRNOP00000023368

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	16	10,182,742 - 10,182,954 (-)	Ensembl

RefSeq Acc Id:

ENSRNOT00000042661 ⟹ ENSRNOP00000042022

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	2	184,905,204 - 184,905,416 (-)	Ensembl

RefSeq Acc Id:

ENSRNOT00000044141 ⟹ ENSRNOP00000042288

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	3	155,980,625 - 155,981,036 (+)	Ensembl
Rnor_6.0 Ensembl	3	164,002,482 - 164,002,694 (+)	Ensembl

RefSeq Acc Id:

ENSRNOT00000050489 ⟹ ENSRNOP00000050353

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	14	94,400,027 - 94,400,239 (+)	Ensembl

RefSeq Acc Id:

XM_001065954 ⟹ XP_001065954

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	3	155,980,656 - 155,981,001 (+)	NCBI
Rnor_6.0	3	164,002,409 - 164,002,748 (+)	NCBI
Rnor_5.0	3	170,159,895 - 170,160,236 (+)	NCBI
RGSC_v3.4	3	158,404,683 - 158,405,010 (+)	RGD

Sequence:

show sequence

AGATGCGTTATTTTTTTTCCGTTCTGTTCGGTGCTCGCTCCTGTGCTGACGCCAGAGCCGAGCG
CCCGTCGCCATGCCTCGGAAAATTGAGGAAATCAAGGACTTTCTACTCACAGCCCGGCGGAAGG
ATGCCAAATCTGTCAAGATCAAGAAAAACAAGGATAATGTAAAGTTCAAGGTCCGCTGTAGCAG
GTACCTCTACACCCTGGTTATCACAGACAAGGAGAAGGCGGAGAAGCTGAAGCAGTCCCTGCCC
CCAGGTTTGGCAGTGAAGGAGCTGAAATGAACAGGACCTCTGCATGTGACTATTAAAAACCCTG
AAAAGTCAAAAAAAAAAAAA

hide sequence

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-P63174-F1-model_v2	AlphaFold	P63174	1-70	view protein structure

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:1587812	AgrOrtholog
BioCyc Gene	G2FUF-46743	BioCyc
Ensembl Genes	ENSRNOG00000030747	Ensembl
	ENSRNOG00000033686	Ensembl
	ENSRNOG00000048701	Ensembl, ENTREZGENE
	ENSRNOG00000049047	Ensembl
NCBI Gene	685963	ENTREZGENE
PhenoGen	Rpl38-ps9	PhenoGen
RatGTEx	ENSRNOG00000030747	RatGTEx
	ENSRNOG00000033686	RatGTEx
	ENSRNOG00000048701	RatGTEx
	ENSRNOG00000049047	RatGTEx

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2022-07-15	Rpl38-ps9	ribosomal protein L38, pseudogene 9	LOC685963	similar to 60S ribosomal protein L38	Name and Symbol and Type changed (type changed from [protein-coding] to [pseudo])	629549	APPROVED
2006-11-19	LOC685963	similar to 60S ribosomal protein L38			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message