Tbc1d22a (TBC1 domain family, member 22a)

Gene: Tbc1d22a (TBC1 domain family, member 22a) Rattus norvegicus

Analyze

Symbol:

Tbc1d22a

Name:

TBC1 domain family, member 22a

RGD ID:

1306588

Description:

Predicted to enable 14-3-3 protein binding activity and protein homodimerization activity. Orthologous to human TBC1D22A (TBC1 domain family member 22A); INTERACTS WITH 2,3,7,8-Tetrachlorodibenzofuran; atrazine; bisphenol A.

Type:

protein-coding

RefSeq Status:

VALIDATED

Previously known as:

LOC366968; LOC678774; RGD1306588; similar to cDNA sequence BC023106; similar to TBC1 domain family member 22A; TBC1 domain family member 22A; TBC1 domain family member 22A-like

RGD Orthologs

Alliance Genes

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	TBC1D22A (TBC1 domain family member 22A)	HGNC	Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):	Tbc1d22a (TBC1 domain family, member 22a)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):	Tbc1d22a (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	TBC1D22A (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	TBC1D22A (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):	Tbc1d22a (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	TBC1D22A (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):	TBC1D22A (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):	Tbc1d22a (TBC1 domain family member 22A)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Other homologs ²
Homo sapiens (human):	CCDC8 (coiled-coil domain containing 8)	HGNC	OMA
Alliance orthologs ³
Mus musculus (house mouse):	Tbc1d22a (TBC1 domain family, member 22a)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PhylomeDB\|SonicParanoid)
Homo sapiens (human):	TBC1D22A (TBC1 domain family member 22A)	Alliance	DIOPT (Ensembl Compara\|HGNC\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PhylomeDB\|SonicParanoid)
Danio rerio (zebrafish):	tbc1d22a (TBC1 domain family, member 22a)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|OMA\|OrthoFinder\|PhylomeDB)
Saccharomyces cerevisiae (baker's yeast):	GYP1	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|OrthoFinder\|OrthoInspector\|PhylomeDB\|SonicParanoid)
Drosophila melanogaster (fruit fly):	CG5745	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|OrthoFinder\|PhylomeDB)
Caenorhabditis elegans (roundworm):	tbc-3	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|OMA\|OrthoFinder\|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):	tbc1d22a	Alliance	DIOPT (Ensembl Compara\|OrthoFinder)

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	7	119,172,284 - 119,457,271 (+)	NCBI		GRCr8
mRatBN7.2	7	117,292,481 - 117,577,473 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	117,292,631 - 117,577,483 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	7	119,044,006 - 119,331,705 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	7	121,269,640 - 121,557,332 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	7	121,239,221 - 121,526,927 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	7	127,081,769 - 127,227,601 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	127,081,978 - 127,223,231 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	7	126,792,288 - 126,930,133 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.1	7	124,240,095 - 124,527,412 (+)	NCBI
Celera	7	113,582,538 - 114,076,520 (+)	NCBI		Celera
Cytogenetic Map	7	q34	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

genetic disease (ISO)

intellectual disability (ISO)

Phelan-McDermid syndrome (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,2-dimethylhydrazine (ISO)

2,2',4,4'-Tetrabromodiphenyl ether (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2,3,7,8-Tetrachlorodibenzofuran (EXP)

3,4-methylenedioxymethamphetamine (ISO)

aflatoxin B1 (ISO)

Aflatoxin B2 alpha (ISO)

antirheumatic drug (ISO)

aristolochic acid A (ISO)

arsane (ISO)

arsenic atom (ISO)

atrazine (EXP)

benzo[a]pyrene (ISO)

benzo[a]pyrene diol epoxide I (ISO)

benzo[e]pyrene (ISO)

bisphenol A (EXP,ISO)

caffeine (ISO)

CGP 52608 (ISO)

chlorpyrifos (ISO)

cisplatin (ISO)

clofibrate (ISO)

coumarin (ISO)

crocidolite asbestos (ISO)

doxorubicin (ISO)

ethanol (ISO)

fenthion (ISO)

formaldehyde (ISO)

FR900359 (ISO)

fulvestrant (ISO)

glyphosate (EXP)

ivermectin (ISO)

methapyrilene (ISO)

methidathion (ISO)

methoxychlor (EXP)

ozone (ISO)

paracetamol (EXP,ISO)

sodium arsenite (ISO)

tert-butyl hydroperoxide (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

regulation of cilium assembly (ISO)

Molecular Function

14-3-3 protein binding (ISO)

GTPase activator activity (IEA)

protein binding (ISO)

protein homodimerization activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	GOA pipeline	RGD automated data pipeline
3.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
4.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:17646400	PMID:18186464	PMID:23572552

Genomics

Comparative Map Data

Tbc1d22a
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	7	119,172,284 - 119,457,271 (+)	NCBI		GRCr8
mRatBN7.2	7	117,292,481 - 117,577,473 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	117,292,631 - 117,577,483 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	7	119,044,006 - 119,331,705 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	7	121,269,640 - 121,557,332 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	7	121,239,221 - 121,526,927 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	7	127,081,769 - 127,227,601 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	127,081,978 - 127,223,231 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	7	126,792,288 - 126,930,133 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.1	7	124,240,095 - 124,527,412 (+)	NCBI
Celera	7	113,582,538 - 114,076,520 (+)	NCBI		Celera
Cytogenetic Map	7	q34	NCBI

TBC1D22A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	22	46,762,650 - 47,175,699 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	22	46,762,617 - 47,175,699 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	22	47,158,547 - 47,571,342 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	22	45,537,213 - 45,948,390 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	22	31,074,220 - 31,486,114 (+)	NCBI		Celera
Cytogenetic Map	22	q13.31	NCBI
HuRef	22	30,103,503 - 30,516,056 (+)	NCBI		HuRef
CHM1_1	22	47,117,886 - 47,530,004 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	22	47,250,621 - 47,665,617 (+)	NCBI		T2T-CHM13v2.0

Tbc1d22a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	86,095,502 - 86,382,704 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	15	86,098,660 - 86,382,704 (+)	Ensembl		GRCm39 Ensembl
GRCm38	15	86,214,411 - 86,498,503 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	86,214,459 - 86,498,503 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	15	86,044,889 - 86,328,933 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	15	86,042,225 - 86,326,269 (+)	NCBI		MGSCv36	mm8
Celera	15	88,356,819 - 88,637,955 (+)	NCBI		Celera
Cytogenetic Map	15	E2	NCBI
cM Map	15	40.56	NCBI

Tbc1d22a
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955413	30,709,724 - 31,026,238 (+)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955413	30,710,432 - 31,025,784 (+)	NCBI	ChiLan1.0	ChiLan1.0

TBC1D22A
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	23	56,605,984 - 57,025,743 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	22	59,297,405 - 59,716,769 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	22	26,934,409 - 27,353,029 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	22	45,830,747 - 46,241,738 (+)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	22	45,830,747 - 46,241,738 (+)	Ensembl	panpan1.1		panPan2

TBC1D22A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	10	19,196,866 - 19,532,103 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	10	19,070,467 - 19,532,062 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	10	19,119,926 - 19,454,053 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	10	19,933,410 - 20,267,704 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	10	19,933,339 - 20,267,651 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	10	19,651,625 - 19,985,731 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	10	19,964,022 - 20,298,045 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	10	20,145,684 - 20,479,843 (-)	NCBI		UU_Cfam_GSD_1.0

Tbc1d22a
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024404945	2,963,792 - 3,272,058 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936629	2,966,507 - 3,272,030 (-)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936629	2,965,289 - 3,272,028 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

TBC1D22A
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	5	2,528,921 - 2,787,304 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	5	2,528,920 - 2,787,313 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	5	126,533 - 312,712 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

TBC1D22A
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	19	29,260,995 - 29,681,768 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	19	29,261,018 - 29,684,409 (+)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666045	95,780,108 - 96,253,332 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Tbc1d22a
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla_female_1.0 Ensembl	NW_004624752	2,903,130 - 3,273,535 (-)	Ensembl	HetGla_female_1.0	HetGla_female_1.0 Ensembl	hetGla2
HetGla 1.0	NW_004624752	2,816,547 - 3,272,693 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Variants

Variants in Tbc1d22a
1005 total Variants

miRNA Target Status

Predicted Target Of

	Summary Value
Count of predictions:	132
Count of miRNA genes:	95
Interacting mature miRNAs:	107
Transcripts:	ENSRNOT00000022945
Prediction methods:	Microtar, Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
61357	Bp38	Blood pressure QTL 38	1.6	0.052	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	7	41333674	119109060	Rat
1300179	Kidm5	Kidney mass QTL 5	3.51		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	7	43747012	135012528	Rat
631504	Cm27	Cardiac mass QTL 27	3.45		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	7	44421311	118198041	Rat
70173	Niddm19	Non-insulin dependent diabetes mellitus QTL 19	4.33	0.00005	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	7	64002457	135012528	Rat
631540	Bw9	Body weight QTL 9	4.5		body mass (VT:0001259)	body weight (CMO:0000012)	7	69736226	117455174	Rat
634331	Pia17	Pristane induced arthritis QTL 17	4.7		joint integrity trait (VT:0010548)	arthritic paw count (CMO:0001460)	7	73829340	130221005	Rat
7411654	Foco25	Food consumption QTL 25	9.3	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	7	75918751	120918751	Rat
7411607	Foco15	Food consumption QTL 15		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	7	75918751	120918751	Rat
1331728	Bp214	Blood pressure QTL 214	2.825		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	80221299	124373579	Rat
1331768	Kidm10	Kidney mass QTL 10	4.62096		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	7	80221299	125221299	Rat
2317052	Aia17	Adjuvant induced arthritis QTL 17	2.13		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	7	81737938	126737938	Rat
634322	Bw12	Body weight QTL 12	0		body mass (VT:0001259)	body weight (CMO:0000012)	7	83153392	128153392	Rat
1358891	Bp265	Blood pressure QTL 265	2.21		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	83591953	134666232	Rat
1358914	Bp266	Blood pressure QTL 266			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	83591953	134666232	Rat
71114	Niddm14	Non-insulin dependent diabetes mellitus QTL 14	4.5		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	7	84257275	129257275	Rat
2298475	Eau6	Experimental allergic uveoretinitis QTL 6		0.0029	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	7	84257275	129257275	Rat
1558655	Swd4	Spike wave discharge measurement QTL 4	3.68	0.0002	brain electrophysiology trait (VT:0010557)	brain spike-and-wave discharge severity grade (CMO:0001988)	7	86983365	131983365	Rat
1549899	Stresp8	Stress response QTL 8	4.37	0.0008	stress-related behavior trait (VT:0010451)	defensive burying duration (CMO:0001961)	7	90482196	135012528	Rat
2299163	Iddm34	Insulin dependent diabetes mellitus QTL 34	2.71		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	7	91281130	135012528	Rat
631687	Hcas1	Hepatocarcinoma susceptibility QTL 1	3.9	0.001	liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	7	91412594	129807172	Rat
731176	Glom5	Glomerulus QTL 5	2.5	0.0035	kidney glomerulus morphology trait (VT:0005325)	count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)	7	96670164	135012528	Rat
1331731	Bp216	Blood pressure QTL 216	2.851		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	102297359	133492884	Rat
731174	Uae23	Urinary albumin excretion QTL 23	2.4	0.0042	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	7	104603555	135012528	Rat
2306821	Bp335	Blood pressure QTL 335		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	7	106571501	135012528	Rat
631663	Bw6	Body weight QTL 6	3.4		body mass (VT:0001259)	body weight (CMO:0000012)	7	111075573	134976056	Rat
1300112	Bp183	Blood pressure QTL 183	3.51		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	7	111182207	135012528	Rat
1331748	Bp215	Blood pressure QTL 215	4.043		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	112308254	133492884	Rat
1357339	Stl14	Serum triglyceride level QTL 14	3.45	0.0001	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	7	112729683	133492707	Rat
1582240	Sffal1	Serum free fatty acids level QTL 1	3.4	0.0021	blood free fatty acid amount (VT:0001553)	serum free fatty acids level (CMO:0000547)	7	116677010	124049952	Rat
631201	Panci1	Pancreas inflammation QTL 1	0	0.001	pancreas integrity trait (VT:0010560)	percentage of study population displaying chronic pancreatitis at a point in time (CMO:0001214)	7	116677189	127103496	Rat

Markers in Region

D7Rat13

Rat Assembly	Chr	Position (strand)	Source	JBrowse
Rnor_5.0	7	126,904,511 - 126,904,662	UniSTS	Rnor5.0
RGSC_v3.4	7	124,315,012 - 124,315,164	RGD	RGSC3.4
RGSC_v3.4	7	124,315,013 - 124,315,164	UniSTS	RGSC3.4
RGSC_v3.1	7	124,349,243 - 124,349,394	RGD
Celera	7	113,690,398 - 113,690,549	UniSTS
RH 3.4 Map	7	930.1	UniSTS
RH 3.4 Map	7	930.1	RGD
RH 2.0 Map	7	723.4	RGD
SHRSP x BN Map	7	70.2799	RGD
Cytogenetic Map	7	q34	UniSTS

BI275785

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	7	117,577,149 - 117,577,309 (+)	MAPPER	mRatBN7.2
Rnor_6.0	7	127,446,924 - 127,447,083	NCBI	Rnor6.0
Rnor_5.0	7	127,155,528 - 127,155,687	UniSTS	Rnor5.0
RGSC_v3.4	7	124,492,863 - 124,493,022	UniSTS	RGSC3.4
Celera	7	114,076,202 - 114,076,361	UniSTS
RH 3.4 Map	7	937.3	UniSTS
Cytogenetic Map	7	q34	UniSTS

RH128649

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	7	117,292,081 - 117,292,275 (+)	MAPPER	mRatBN7.2
Rnor_6.0	7	127,081,377 - 127,081,570	NCBI	Rnor6.0
Rnor_5.0	7	126,792,493 - 126,792,686	UniSTS	Rnor5.0
RGSC_v3.4	7	124,205,391 - 124,205,584	UniSTS	RGSC3.4
Celera	7	113,582,146 - 113,582,339	UniSTS
RH 3.4 Map	7	931.4	UniSTS
Cytogenetic Map	7	q34	UniSTS

AU048899

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	7	117,486,066 - 117,486,255 (+)	MAPPER	mRatBN7.2
Rnor_6.0	7	127,356,060 - 127,356,248	NCBI	Rnor6.0
Rnor_5.0	7	127,064,746 - 127,064,934	UniSTS	Rnor5.0
RGSC_v3.4	7	124,401,570 - 124,401,758	UniSTS	RGSC3.4
Celera	7	113,985,230 - 113,985,418	UniSTS
Cytogenetic Map	7	q34	UniSTS

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium	3	39	38	22	19	22	8	11	74	35	41	11	8
Low		4	19	19		19
Below cutoff

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NM_001401878	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_006226193	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_006242171	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_017603479	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_039080323	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_039080326	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_039080327	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_001844459	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_005487292	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_593675	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC135400	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000007	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSRNOT00000022945 ⟹ ENSRNOP00000022945

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	117,292,631 - 117,426,248 (+)	Ensembl
Rnor_6.0 Ensembl	7	127,081,978 - 127,223,231 (+)	Ensembl

RefSeq Acc Id:

ENSRNOT00000094564 ⟹ ENSRNOP00000080048

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	117,292,631 - 117,577,483 (+)	Ensembl

RefSeq Acc Id:

ENSRNOT00000101601 ⟹ ENSRNOP00000081731

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	117,292,631 - 117,527,699 (+)	Ensembl

RefSeq Acc Id:

ENSRNOT00000115663 ⟹ ENSRNOP00000087718

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	117,292,631 - 117,573,903 (+)	Ensembl

RefSeq Acc Id:

NM_001401878 ⟹ NP_001388807

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	119,172,365 - 119,457,271 (+)	NCBI
mRatBN7.2	7	117,292,556 - 117,577,473 (+)	NCBI

RefSeq Acc Id:

XM_039080323 ⟹ XP_038936251

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	119,172,284 - 119,457,265 (+)	NCBI
mRatBN7.2	7	117,292,481 - 117,577,467 (+)	NCBI

RefSeq Acc Id:

XM_039080326 ⟹ XP_038936254

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	119,172,284 - 119,403,357 (+)	NCBI
mRatBN7.2	7	117,292,481 - 117,505,898 (+)	NCBI

RefSeq Acc Id:

XM_039080327 ⟹ XP_038936255

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	119,220,577 - 119,457,265 (+)	NCBI
mRatBN7.2	7	117,341,002 - 117,577,468 (+)	NCBI

RefSeq Acc Id:

XR_005487292

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	119,172,284 - 119,455,686 (+)	NCBI
mRatBN7.2	7	117,292,481 - 117,575,916 (+)	NCBI

RefSeq Acc Id:

XR_593675

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	119,172,284 - 119,271,987 (+)	NCBI
mRatBN7.2	7	117,292,481 - 117,392,178 (+)	NCBI
Rnor_6.0	7	127,081,769 - 127,189,282 (+)	NCBI

Sequence:

show sequence

TCATGGCGTCAAGCACAGCCTGAAACGGAGGCGGGACTTCCGGGATCGCCGAGTCACAACTTCC
GGACGGAGGCGGAAGCGCCTCTCGGGTCTACGCTCCGGAGTCCTGGTATCTCTGAGGGGCCAAC
CGGGCACAGGAGAGGGCCGCTGGAGGTTGGCCGGCCGCTCTCGGGTGTCAGGGTTGCGGATCTG
AGGGATGAGGAGCGGCCATGGCCAGCGACGGGGCCAGGAAGCAGTTCTGGAAGCGCAGCAACAG
CAAGGTCCCGGGCAGCATCCAGCATGTGTATGGAGCCCAGCACCCACCTTTTGATCCGCTGTTA
CACGGCACCTTGCTCAAGTCCACGCCCAAGGTGCCCACCACCCCAGTGAAGGCCAAGCGGGTCA
GCACCTTCCAGGAGTTTGAGAGCAATACCAGTGACGCTTGGGATGCGGGAGAAGATGACGATGA
GCTCCTGGCAATGGCGACAGAGAGCCTGAACTCTGAGGTGGTCATGGAGACAGCACATCGTGTC
CTGCGCAATCACAGCCAGAGGCAGAACCAGCCCTCACAGAAGAAGCCAGAGCCAGAGCCTCAGC
CCATAGCAGAGCCTCCTGTAGCTCCCAGTGGCGACCTTCGCCTGGTGAAGTCTGTCAGTGAGAG
CCACACTCCTTGTCCTTCAGAGAGCACCAGTGATACAGTCCCTCTGCAGCGGTCCCAGTCTCTT
CCCCACTCAGCCACTGTGACACTGAGTGGGACATCTGACACTCATGCCCTTGGTGGCTCAGCCC
TGAGTAAGAGAGAGACCTCTCGACTGGACAAGTTCAAACAGCTGCTTGCTGGCCCCAACACAGA
CCTTGAGGAATTACGGAAGCTGAGCTGGTCCGGAATCCCAAAGCCAGTTCGTCCAATGACATGG
AAACTTCTCTCAGGTTACCTTCCTGCCAATGTTGACCGAAGACCAGCCACGCTGCAGAGGAAAC
AGAAGGAATACTTTGCTTTCATTGAGCACTATTACAACTCTAGGAATGACGAAGTTCACCAGGA
CACCTATCGCCAGATCCATATTGACATCCCTCGGATGAGCCCAGAAGCACTGATTCTTCAGCCC
AAGGTGACAGAGTAAATGCATTTTGAAACGTGGACATCTCTTGCCTGCGCAGTAAAGCTGCTAA
AAAATTCCGACATTGCTGAAGTAAAAGTGCTCGTAGATTGTGGAGCACAAAAGGGGAGAATGAG
TTTCCATAGGAGCGGCCGCTCTGAGGCACTTCTCTTTGATTGCCCTTCTCAGTGGTGTGCTTAC
AGTGGCTGGAAACAAGGATTTTCGAAAGGATCTTGTTTATCTGGGCCATCCGACACCCTGCCAG
TGGATACGTTCAGGGAATAAATGACCTGGT

hide sequence

Protein Sequences


Protein RefSeqs	NP_001388807	(Get FASTA)	NCBI Sequence Viewer
	XP_038936251	(Get FASTA)	NCBI Sequence Viewer
	XP_038936254	(Get FASTA)	NCBI Sequence Viewer
	XP_038936255	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00000022945.8
	ENSRNOP00000080048
	ENSRNOP00000080048.1
	ENSRNOP00000081731
	ENSRNOP00000081731.1
	ENSRNOP00000087718.1

RefSeq Acc Id:

ENSRNOP00000022945 ⟸ ENSRNOT00000022945

RefSeq Acc Id:	XP_038936251 ⟸ XM_039080323
- Peptide Label:	isoform X1
- UniProtKB:	A0A8I5ZPV1 (UniProtKB/TrEMBL), A0A8I6AH78 (UniProtKB/TrEMBL)

RefSeq Acc Id:	XP_038936254 ⟸ XM_039080326
- Peptide Label:	isoform X2
- UniProtKB:	A0A8I6AH78 (UniProtKB/TrEMBL)

RefSeq Acc Id:	XP_038936255 ⟸ XM_039080327
- Peptide Label:	isoform X3

RefSeq Acc Id:

ENSRNOP00000081731 ⟸ ENSRNOT00000101601

RefSeq Acc Id:

ENSRNOP00000080048 ⟸ ENSRNOT00000094564

RefSeq Acc Id:

ENSRNOP00000087718 ⟸ ENSRNOT00000115663

RefSeq Acc Id:

NP_001388807 ⟸ NM_001401878

Protein Domains

Rab-GAP TBC

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-D3Z994-F1-model_v2	AlphaFold	D3Z994	1-372	view protein structure

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:1306588	AgrOrtholog
BioCyc Gene	G2FUF-32517	BioCyc
Ensembl Genes	ENSRNOG00000017057	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
Ensembl Transcript	ENSRNOT00000022945.8	UniProtKB/TrEMBL
	ENSRNOT00000094564.1	UniProtKB/TrEMBL
	ENSRNOT00000101601	ENTREZGENE
	ENSRNOT00000101601.1	UniProtKB/TrEMBL
	ENSRNOT00000115663.1	UniProtKB/TrEMBL
Gene3D-CATH	putative rabgap domain of human tbc1 domain family member 14 like domains	UniProtKB/TrEMBL
	Ypt/Rab-GAP domain of gyp1p, domain 3	UniProtKB/TrEMBL
InterPro	Rab-GTPase-TBC_dom	UniProtKB/TrEMBL
	Rab-GTPase_TBC_sf	UniProtKB/TrEMBL
NCBI Gene	Tbc1d22a	ENTREZGENE
PANTHER	TBC1 DOMAIN FAMILY MEMBER 22A	UniProtKB/TrEMBL
	TBC1 DOMAIN FAMILY MEMBER GTPASE-ACTIVATING PROTEIN	UniProtKB/TrEMBL
Pfam	RabGAP-TBC	UniProtKB/TrEMBL
PhenoGen	Tbc1d22a	PhenoGen
PROSITE	TBC_RABGAP	UniProtKB/TrEMBL
RatGTEx	ENSRNOG00000017057	RatGTEx
SMART	TBC	UniProtKB/TrEMBL
Superfamily-SCOP	RabGAP_TBC	UniProtKB/TrEMBL
UniProt	A0A8I5ZPV1	ENTREZGENE, UniProtKB/TrEMBL
	A0A8I5ZSU1_RAT	UniProtKB/TrEMBL
	A0A8I6AH78	ENTREZGENE, UniProtKB/TrEMBL
	D3Z994_RAT	UniProtKB/TrEMBL

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2021-03-09	Tbc1d22a	TBC1 domain family, member 22a	LOC678774	similar to TBC1 domain family member 22A	Data merged from RGD:1596910	737654	PROVISIONAL
2012-07-02	Tbc1d22a	TBC1 domain family, member 22a	LOC689443	similar to TBC1 domain family member 22A	Data merged from RGD:1592319	1643240	APPROVED
2008-04-30	Tbc1d22a	TBC1 domain family, member 22a	Tbc1d22a_predicted	TBC1 domain family, member 22a (predicted)	'predicted' is removed	2292626	APPROVED
2006-11-20	LOC689443	similar to TBC1 domain family member 22A			Symbol and Name status set to provisional	70820	PROVISIONAL
2006-11-20	LOC678774	similar to TBC1 domain family member 22A			Symbol and Name status set to provisional	70820	PROVISIONAL
2006-03-30	Tbc1d22a_predicted	TBC1 domain family, member 22a (predicted)	RGD1306588_predicted	similar to cDNA sequence BC023106 (predicted)	Symbol and Name updated	1299863	APPROVED
2005-01-20	RGD1306588_predicted	similar to cDNA sequence BC023106 (predicted)	LOC366968_predicted		Symbol and Name status set to approved	1331353	APPROVED
2005-01-12	LOC366968_predicted	similar to cDNA sequence BC023106 (predicted)			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar