Gene: Trav34l (T cell receptor alpha variable 34 like) Rattus norvegicus |
|
Analyze |
|
Symbol: |
Trav34l (Ensembl: LOC108353026) |
Name: |
T cell receptor alpha variable 34 like (Ensembl:uncharacterized LOC108353026) |
RGD ID: |
11454121 |
Description: |
Predicted to be located in membrane. |
Type: |
gene (Ensembl: protein-coding)
|
RefSeq Status: |
MODEL |
Previously known as: |
ENSRNOG00000068621; LOC108353026; uncharacterized LOC108353026 |
RGD Orthologs |
|
Alliance Genes |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
mRatBN7.2 - mRatBN7.2 Assembly |
Position: |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 15 | 31,297,513 - 31,299,617 (+) | NCBI | | GRCr8 | | | mRatBN7.2 | 15 | 27,327,456 - 27,329,554 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 15 | 27,327,462 - 27,328,325 (+) | NCBI | | mRatBN7.2 Ensembl | | | mRatBN7.2 Ensembl | 15 | 27,327,462 - 27,328,325 (+) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 | 15 | 32,515,873 - 32,517,280 (+) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Celera | 15 | 26,910,427 - 26,911,834 (+) | NCBI | | Celera | | | Cytogenetic Map | 15 | p13 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
Comparative Map Data
Trav34l (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 15 | 31,297,513 - 31,299,617 (+) | NCBI | | GRCr8 | | | mRatBN7.2 | 15 | 27,327,456 - 27,329,554 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 15 | 27,327,462 - 27,328,325 (+) | NCBI | | mRatBN7.2 Ensembl | | | mRatBN7.2 Ensembl | 15 | 27,327,462 - 27,328,325 (+) | Ensembl | | mRatBN7.2 Ensembl | | | Rnor_6.0 | 15 | 32,515,873 - 32,517,280 (+) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Celera | 15 | 26,910,427 - 26,911,834 (+) | NCBI | | Celera | | | Cytogenetic Map | 15 | p13 | NCBI | | | | |
|
TRAV34 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 14 | 22,207,534 - 22,208,129 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 14 | 22,207,522 - 22,208,129 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 14 | 22,675,430 - 22,676,025 (+) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 14 | 21,745,270 - 21,745,865 (+) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 14 | 2,538,968 - 2,539,563 (+) | NCBI | | Celera | | | Cytogenetic Map | 14 | q11.2 | NCBI | | | | | HuRef | 14 | 2,793,055 - 2,793,650 (+) | NCBI | | HuRef | | | CHM1_1 | 14 | 22,675,436 - 22,676,031 (+) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 14 | 16,405,299 - 16,405,894 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
Trdv1 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 14 | 54,119,069 - 54,119,674 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 14 | 54,119,069 - 54,119,674 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 14 | 53,881,612 - 53,882,217 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 14 | 53,881,612 - 53,882,217 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | MGSCv37 | 14 | 54,501,287 - 54,501,892 (+) | NCBI | GRCm37 | MGSCv37 | mm9 | NCBIm37 | Cytogenetic Map | 14 | C2 | NCBI | | | | | cM Map | 14 | 27.55 | NCBI | | | | |
|
QTLs in Region (mRatBN7.2)
1354657 | Despr13 | Despair related QTL 13 | | 0.0022 | locomotor behavior trait (VT:0001392) | amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) | 15 | 1 | 29912054 | Rat | 8552920 | Pigfal8 | Plasma insulin-like growth factor 1 level QTL 8 | 3 | | blood insulin-like growth factor amount (VT:0010479) | plasma insulin-like growth factor 1 level (CMO:0001299) | 15 | 1 | 34723002 | Rat | 8694361 | Abfw6 | Abdominal fat weight QTL 6 | 10.2 | 0.001 | visceral adipose mass (VT:0010063) | abdominal fat pad weight to body weight ratio (CMO:0000095) | 15 | 1 | 34723002 | Rat | 9589149 | Insul29 | Insulin level QTL 29 | 9.06 | 0.001 | blood insulin amount (VT:0001560) | plasma insulin level (CMO:0000342) | 15 | 1 | 34723002 | Rat | 731170 | Pur3 | Proteinuria QTL 3 | 2.3 | 0.0005 | urine protein amount (VT:0005160) | urine protein excretion rate (CMO:0000759) | 15 | 1 | 41686771 | Rat | 1641887 | Alcrsp14 | Alcohol response QTL 14 | | | response to alcohol trait (VT:0010489) | brain neurotensin receptor 1 density (CMO:0002068) | 15 | 1 | 42356671 | Rat | 2298549 | Neuinf12 | Neuroinflammation QTL 12 | 3.5 | | nervous system integrity trait (VT:0010566) | spinal cord beta-2 microglobulin mRNA level (CMO:0002125) | 15 | 1 | 55302115 | Rat | 10401805 | Kidm51 | Kidney mass QTL 51 | | | kidney mass (VT:0002707) | both kidneys wet weight (CMO:0000085) | 15 | 306329 | 45306329 | Rat | 738017 | Hcas7 | Hepatocarcinoma susceptibility QTL 7 | 2.91 | | liver integrity trait (VT:0010547) | liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) | 15 | 2266368 | 46921453 | Rat | 1582251 | Gluco24 | Glucose level QTL 24 | 3.2 | 0.0008 | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 15 | 5530756 | 50530756 | Rat | 631273 | Lecl2 | Lens clarity QTL 2 | | 0.001 | lens clarity trait (VT:0001304) | age of onset/diagnosis of cataract (CMO:0001584) | 15 | 10596089 | 55596089 | Rat | 2300167 | Bmd63 | Bone mineral density QTL 63 | 5.9 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 15 | 11111142 | 56111142 | Rat | 2300173 | Bmd62 | Bone mineral density QTL 62 | 12.8 | 0.0001 | lumbar vertebra mineral mass (VT:0010511) | volumetric bone mineral density (CMO:0001553) | 15 | 11111142 | 56111142 | Rat | 2293688 | Bss29 | Bone structure and strength QTL 29 | 5.31 | 0.0001 | femur morphology trait (VT:0000559) | femur midshaft cortical cross-sectional area (CMO:0001663) | 15 | 11111142 | 56111142 | Rat | 2317750 | Glom26 | Glomerulus QTL 26 | 4.3 | | urine protein amount (VT:0005160) | urine protein level (CMO:0000591) | 15 | 12496141 | 65205939 | Rat | 5685002 | Bss103 | Bone structure and strength QTL 103 | 2.8 | | tibia strength trait (VT:1000284) | tibia total energy absorbed before break (CMO:0001736) | 15 | 14481165 | 28469888 | Rat | 61424 | Scl1 | Serum cholesterol level QTL 1 | 7.7 | 0.001 | blood cholesterol amount (VT:0000180) | serum total cholesterol level (CMO:0000363) | 15 | 16725528 | 80672115 | Rat | 1331729 | Rf42 | Renal function QTL 42 | 3.071 | | kidney blood vessel physiology trait (VT:0100012) | absolute change in renal blood flow rate (CMO:0001168) | 15 | 17362897 | 73690657 | Rat | 631550 | Bw7 | Body weight QTL 7 | 3.6 | | body mass (VT:0001259) | body weight (CMO:0000012) | 15 | 19856566 | 34924750 | Rat | 2324620 | Coatc3 | Coat color QTL 3 | | | coat/hair pigmentation trait (VT:0010463) | pigmented coat/hair area to total coat/hair area ratio (CMO:0001810) | 15 | 19856566 | 46187442 | Rat | 10054130 | Srcrt8 | Stress Responsive Cort QTL 8 | 2.18 | 0.0085 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 15 | 22117933 | 67117933 | Rat | 1578646 | Bmd18 | Bone mineral density QTL 18 | 5.2 | | femur mineral mass (VT:0010011) | trabecular volumetric bone mineral density (CMO:0001729) | 15 | 22806240 | 98288169 | Rat | 1578647 | Bmd17 | Bone mineral density QTL 17 | 4 | | femur mineral mass (VT:0010011) | total volumetric bone mineral density (CMO:0001728) | 15 | 22806240 | 98288169 | Rat | 1578660 | Bss19 | Bone structure and strength QTL 19 | 4.3 | | femur morphology trait (VT:0000559) | bone trabecular cross-sectional area (CMO:0002311) | 15 | 22806240 | 98288169 | Rat | |
Expression
Sequence
RefSeq Acc Id: |
ENSRNOT00000103116 ⟹ ENSRNOP00000080146 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 15 | 27,327,462 - 27,328,325 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_001841511 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
Rnor_6.0 | 15 | 32,515,873 - 32,517,280 (+) | NCBI |
|
Sequence: |
TTGAGTATCCAAGCCTCCCAGCCCAGCTACGCAGGCACTTACCTCTGTGCAGGGAGCGCACAGT GGTCTATAGACTGCCGCGGGCTGTCTCCAAACCTGCAGCTGGGCCACAGCTGCTCTGACACAGG GCCCCTGAGGCAGGACTAGAGCACTTGCCAAAATGAGAGACTCGAGGGTGCAGTTGTCTCCCTA CATAGCAGTATAAAGCTTTGAGGAAGGGGACAAGGGACAGGACCCATCCTTGGCAGCCACTTTC CTTAAGGTGCTGATACCTGTTACCCCATGGTATAAATGTGCATCCCTTCTACTTGTCCTTGGAG ACCTTGAGCAGCTCCAAGGCATACAAAGTGCATACATCTAGAATCACACAACGGAGCCTCTGCT TGCGGACTTTCTCCATCACTTTGTGACCACTATCAAGGCGCTGGGGCAGCACAAGGCAATGGCT ACTCTTCTTTGATGGCAGCAGAGGCAGGAAGGACCTAAAAATAATATTTACACCGTTAATAAAA TGGCAGTCTCAAATTGA
hide sequence
|
RefSeq Acc Id: |
XR_001846266 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
Celera | 15 | 26,910,427 - 26,911,834 (+) | NCBI |
|
Sequence: |
TTGAGTATCCAAGCCTCCCAGCCCAGCTACGCAGGCACTTACCTCTGTGCAGGGAGCGCACAGT GGTCTATAGACTGCCGCGGGCTGTCTCCAAACCTGCAGCTGGGCCACAGCTGCTCTGACACAGG GCCCCTGAGGCAGGACTAGAGCACTTGCCAAAATGAGAGACTCGAGGGTGCAGTTGTCTCCCTA CATAGCAGTATAAAGCTTTGAGGAAGGGGACAAGGGACAGGACCCATCCTTGGCAGCCACTTTC CTTAAGGTGCTGATACCTGTTACCCCATGGTATAAATGTGCATCCCTTCTACTTGTCCTTGGAG ACCTTGAGCAGCTCCAAGGCATACAAAGTGCATACATCTAGAATCACACAACGGAGCCTCTGCT TGCGGACTTTCTCCATCACTTTGTGACCACTATCAAGGCGCTGGGGCAGCACAAGGCAATGGCT ACTCTTCTTTGATGGCAGCAGAGGCAGGAAGGACCTAAAAATAATATTTACACCGTTAATAAAA TGGCAGTCTCAAATTGA
hide sequence
|
RefSeq Acc Id: |
ENSRNOP00000080146 ⟸ ENSRNOT00000103116 |
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2023-09-19 |
Trav34l |
T cell receptor alpha variable 34 like |
LOC108353026 |
uncharacterized LOC108353026 |
Symbol and Name Changed |
1299863 |
APPROVED |
2022-06-02 |
LOC108353026 |
uncharacterized LOC108353026 |
ENSRNOG00000068621 |
|
Data merged from RGD:150343895 |
737654 |
PROVISIONAL |
2021-08-31 |
ENSRNOG00000068621 |
|
|
|
Symbol and Name status set to provisional |
45752 |
PROVISIONAL |
2016-08-02 |
LOC108353026 |
uncharacterized LOC108353026 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|