Gene: LOC108351892 (uncharacterized LOC108351892) Rattus norvegicus |
|
Analyze |
|
Symbol: |
LOC108351892 |
Name: |
uncharacterized LOC108351892 |
RGD ID: |
11376343 |
Description: |
|
Type: |
ncrna
|
RefSeq Status: |
MODEL |
Latest Assembly: |
mRatBN7.2 - mRatBN7.2 Assembly |
Position: |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI | | GRCr8 | | | mRatBN7.2 | 9 | 15,486,492 - 15,493,269 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | Rnor_6.0 | 9 | 17,871,164 - 17,873,333 (+) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Celera | 9 | 13,229,648 - 13,231,821 (+) | NCBI | | Celera | | | Cytogenetic Map | 9 | q12 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (mRatBN7.2)
70226 | Eae4 | Experimental allergic encephalomyelitis QTL 4 | | | nervous system integrity trait (VT:0010566) | experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) | 9 | 1 | 25661317 | Rat | 9589055 | Scfw5 | Subcutaneous fat weight QTL 5 | 5.55 | 0.001 | subcutaneous adipose mass (VT:1000472) | abdominal subcutaneous fat pad weight (CMO:0002069) | 9 | 1 | 37999212 | Rat | 7411592 | Foco8 | Food consumption QTL 8 | 7.4 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 9 | 1 | 37999212 | Rat | 9589158 | Gluco65 | Glucose level QTL 65 | 6.82 | 0.001 | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | 9 | 1 | 37999212 | Rat | 1300124 | Cm4 | Cardiac mass QTL 4 | 3.55 | | heart mass (VT:0007028) | heart weight to body weight ratio (CMO:0000074) | 9 | 1 | 40594091 | Rat | 1298088 | Edpm11 | Estrogen-dependent pituitary mass QTL 11 | 2.5 | | pituitary gland mass (VT:0010496) | pituitary gland wet weight (CMO:0000853) | 9 | 1 | 43718459 | Rat | 1641911 | Alcrsp13 | Alcohol response QTL 13 | | | response to alcohol trait (VT:0010489) | brain neurotensin receptor 1 density (CMO:0002068) | 9 | 1 | 43718459 | Rat | 10054125 | Srcrt7 | Stress Responsive Cort QTL 7 | 3.33 | 0.0011 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 9 | 1 | 87073594 | Rat | 1331757 | Cdexp1 | CD45RC expression in CD8 T cells QTL 1 | 4.3 | | CD8-positive T cell quantity (VT:0008077) | blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990) | 9 | 1024537 | 67509080 | Rat | 1354650 | Despr5 | Despair related QTL 5 | 4.01 | 0.0017 | locomotor behavior trait (VT:0001392) | amount of time spent in voluntary immobility (CMO:0001043) | 9 | 1254084 | 46254084 | Rat | 2303559 | Gluco54 | Glucose level QTL 54 | 2 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 9 | 1254084 | 46254084 | Rat | 61425 | Cia15 | Collagen induced arthritis QTL 15 | 4.6 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | 9 | 5109826 | 42921101 | Rat | 631211 | Bw4 | Body weight QTL4 | 5.31 | | retroperitoneal fat pad mass (VT:0010430) | retroperitoneal fat pad weight to body weight ratio (CMO:0000635) | 9 | 5109826 | 50109826 | Rat | 11353947 | Bp392 | Blood pressure QTL 392 | | | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 9 | 7283252 | 52283252 | Rat | 61450 | Ciaa3 | CIA Autoantibody QTL 3 | 6.5 | | blood autoantibody amount (VT:0003725) | calculated serum anti-type 2 collagen antibody titer (CMO:0001279) | 9 | 7954720 | 22071169 | Rat | 9589133 | Insul26 | Insulin level QTL 26 | 17.96 | 0.001 | blood insulin amount (VT:0001560) | plasma insulin level (CMO:0000342) | 9 | 8952560 | 53952560 | Rat | 7411609 | Foco16 | Food consumption QTL 16 | 25.6 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 9 | 8952560 | 53952560 | Rat | 1600365 | Mcs20 | Mammary carcinoma susceptibility QTL 20 | 3 | | mammary gland integrity trait (VT:0010552) | mammary tumor growth rate (CMO:0000344) | 9 | 13533770 | 42791750 | Rat | |
Expression
Sequence
RefSeq Acc Id: |
XR_001839757 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI | mRatBN7.2 | 9 | 15,486,492 - 15,493,260 (+) | NCBI | Rnor_6.0 | 9 | 17,871,164 - 17,873,333 (+) | NCBI |
|
Sequence: |
GTGAGAGGAGGAAGGCCAGATGGCACAGATGGACTGGGAGGGGATCAGGAGCCGGCAGTCAATG AGCAATTAAGGCTGATTGGCATTTCAGTCAGGAGGCTGTCTAATGGGAATGGTGGCGGGGAGGG GAGGGGTGCAGGGAGGGGAGGAGGTGTGGCAGGCAGAGGTGGGGAGTGGCTTGGTGATATGGGA GCACACGAAGTAGGATGCTGTCCCTGACTTCTATCCCAGTTCTGGAAGCTTCCAAGGCTCACCT GCGTGGCCACATCAAAGCGCAGCCGCTCCGGGTTGAGATGGGAGCCCCGCTGTTCGGTGGTTGG TCCGAGCGTCTGCCGAAGTGCCCAGTTCAGCAGAGCTGCACTCGGTCCCCGACTTGTAAGCACT CGGGAGCCATGGCCTCATGCAGGATGAAGCCTCCACAGACCTGAGCCCGGGC
hide sequence
|
RefSeq Acc Id: |
XR_005489463 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI | mRatBN7.2 | 9 | 15,486,752 - 15,493,259 (+) | NCBI |
|
RefSeq Acc Id: |
XR_005489464 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI | mRatBN7.2 | 9 | 15,486,752 - 15,493,269 (+) | NCBI |
|
RefSeq Acc Id: |
XR_005489465 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI | mRatBN7.2 | 9 | 15,486,752 - 15,493,265 (+) | NCBI |
|
RefSeq Acc Id: |
XR_010054943 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI |
|
RefSeq Acc Id: |
XR_010054944 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI |
|
RefSeq Acc Id: |
XR_010054945 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI |
|
RefSeq Acc Id: |
XR_010054946 |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 9 | 22,983,927 - 22,993,754 (+) | NCBI |
|
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2016-08-02 |
LOC108351892 |
uncharacterized LOC108351892 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|